Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405481249:

Variant ID: vg0405481249 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5481249
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTAACTCTTAGAAATTTTTCAACACATTCTAATCGTACTTCATTTTTTTTAGCATTGACAAGTCGCTCCGAACACATATATAGATGTTTATTATTTCT[G/A,T]
TAACACTAATAAAGCGTTATGGCTTATAATAGTATCCGATTGATCCAGACAATTTTCGTAAACAGAATACATCGATTCGGTAGTGTTGGATAATGTTGAA

Reverse complement sequence

TTCAACATTATCCAACACTACCGAATCGATGTATTCTGTTTACGAAAATTGTCTGGATCAATCGGATACTATTATAAGCCATAACGCTTTATTAGTGTTA[C/T,A]
AGAAATAATAAACATCTATATATGTGTTCGGAGCGACTTGTCAATGCTAAAAAAAATGAAGTACGATTAGAATGTGTTGAAAAATTTCTAAGAGTTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	10.20%	0.08%	0.00%	T: 0.36%
All Indica	2759	98.80%	1.10%	0.07%	0.00%	NA
All Japonica	1512	70.50%	28.40%	0.13%	0.00%	T: 0.93%
Aus	269	99.60%	0.00%	0.00%	0.00%	T: 0.37%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	97.30%	2.60%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	66.10%	33.00%	0.00%	0.00%	T: 0.91%
Tropical Japonica	504	70.80%	28.20%	0.20%	0.00%	T: 0.79%
Japonica Intermediate	241	83.80%	14.50%	0.41%	0.00%	T: 1.24%
VI/Aromatic	96	90.60%	8.30%	0.00%	0.00%	T: 1.04%
Intermediate	90	85.60%	13.30%	0.00%	0.00%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405481249	G -> A	LOC_Os04g10140.1	upstream_gene_variant ; 1531.0bp to feature; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N
vg0405481249	G -> A	LOC_Os04g10160.1	upstream_gene_variant ; 3519.0bp to feature; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N
vg0405481249	G -> A	LOC_Os04g10150.1	downstream_gene_variant ; 2192.0bp to feature; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N
vg0405481249	G -> A	LOC_Os04g10140-LOC_Os04g10150	intergenic_region ; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N
vg0405481249	G -> T	LOC_Os04g10140.1	upstream_gene_variant ; 1531.0bp to feature; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N
vg0405481249	G -> T	LOC_Os04g10160.1	upstream_gene_variant ; 3519.0bp to feature; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N
vg0405481249	G -> T	LOC_Os04g10150.1	downstream_gene_variant ; 2192.0bp to feature; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N
vg0405481249	G -> T	LOC_Os04g10140-LOC_Os04g10150	intergenic_region ; MODIFIER	silent_mutation	Average:57.906; most accessible tissue: Callus, score: 84.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405481249	8.56E-07	NA	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	NA	6.04E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	8.20E-09	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	3.64E-06	5.98E-10	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	6.57E-10	2.98E-10	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	9.57E-09	9.56E-09	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	5.63E-08	NA	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	2.00E-06	1.56E-09	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	9.62E-06	NA	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	1.11E-06	1.11E-06	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	6.43E-12	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	6.45E-08	2.57E-11	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	8.14E-14	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	1.87E-09	4.57E-13	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	6.66E-13	6.70E-13	mr1525_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	1.83E-10	1.83E-10	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	5.33E-13	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405481249	1.39E-08	8.18E-14	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251