Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405465111:

Variant ID: vg0405465111 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5465111
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GCAGCAGAAGGCTTTGGATAGTATTAAGGAATATCTTAGCTCTCCTCCAGTTTTGATTCCTCCACAAAAGTGAGTACATTTTAGATTATATCTATCAGCC[T/G,A]
GTGAGAATTCAATCGGCTCGGTTTTAATTCAGGAGCTTGAAGGAAAAGAAAGAGTTGTGTTCTATTTGAGTCGTCGGCTCTTGGATGCAGAAACAATATA

Reverse complement sequence

TATATTGTTTCTGCATCCAAGAGCCGACGACTCAAATAGAACACAACTCTTTCTTTTCCTTCAAGCTCCTGAATTAAAACCGAGCCGATTGAATTCTCAC[A/C,T]
GGCTGATAGATATAATCTAAAATGTACTCACTTTTGTGGAGGAATCAAAACTGGAGGAGAGCTAAGATATTCCTTAATACTATCCAAAGCCTTCTGCTGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.80%	31.30%	0.63%	36.29%	A: 0.04%
All Indica	2759	13.30%	30.80%	0.87%	55.06%	A: 0.04%
All Japonica	1512	72.20%	26.30%	0.00%	1.52%	NA
Aus	269	4.80%	48.30%	0.37%	46.10%	A: 0.37%
Indica I	595	18.50%	2.00%	1.51%	77.98%	NA
Indica II	465	16.60%	48.40%	1.08%	33.98%	NA
Indica III	913	6.10%	43.40%	0.55%	49.84%	A: 0.11%
Indica Intermediate	786	15.60%	27.50%	0.64%	56.23%	NA
Temperate Japonica	767	72.50%	27.50%	0.00%	0.00%	NA
Tropical Japonica	504	65.70%	30.60%	0.00%	3.77%	NA
Japonica Intermediate	241	84.60%	13.70%	0.00%	1.66%	NA
VI/Aromatic	96	4.20%	63.50%	3.12%	29.17%	NA
Intermediate	90	30.00%	44.40%	2.22%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405465111	T -> A	LOC_Os04g10110.1	downstream_gene_variant ; 3315.0bp to feature; MODIFIER	silent_mutation	Average:29.843; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0405465111	T -> A	LOC_Os04g10130.1	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:29.843; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0405465111	T -> A	LOC_Os04g10120.1	intron_variant ; MODIFIER	silent_mutation	Average:29.843; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0405465111	T -> DEL	N	N	silent_mutation	Average:29.843; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0405465111	T -> G	LOC_Os04g10110.1	downstream_gene_variant ; 3315.0bp to feature; MODIFIER	silent_mutation	Average:29.843; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0405465111	T -> G	LOC_Os04g10130.1	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:29.843; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0405465111	T -> G	LOC_Os04g10120.1	intron_variant ; MODIFIER	silent_mutation	Average:29.843; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405465111	2.63E-07	7.47E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	1.23E-06	3.31E-07	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	NA	2.43E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	1.47E-06	1.47E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	7.57E-06	7.57E-06	mr1581	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	4.71E-09	2.68E-17	mr1626	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	NA	9.20E-07	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	2.47E-07	8.69E-09	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	5.86E-08	NA	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	1.63E-07	1.63E-07	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	3.67E-06	3.67E-06	mr1866	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	4.96E-08	4.32E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	9.23E-08	1.46E-09	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	4.09E-08	4.00E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	NA	8.77E-07	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	1.20E-08	2.01E-11	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	3.96E-07	3.97E-07	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	6.49E-08	6.49E-08	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	6.27E-09	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405465111	4.01E-11	1.08E-13	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251