Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405463763:

Variant ID: vg0405463763 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5463763
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, A: 0.37, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCCTCAAAATGGTTTTAGGTTGGGCTCGAGGTGCATGGTTTTGATAGTAGCACCTCGGCCACCATAAGGACCGGTCTTCGGGCCTCTGTTGTAAAGC[T/A]
CTACCGTACTTCCACATGTCTAGTGGGTAAGGCTTAGTTTGTGGCTCAGTCTGGTCATAAACAAAGGTACACGGATGGAGATGGACGAAGTCGGGGCTCG

Reverse complement sequence

CGAGCCCCGACTTCGTCCATCTCCATCCGTGTACCTTTGTTTATGACCAGACTGAGCCACAAACTAAGCCTTACCCACTAGACATGTGGAAGTACGGTAG[A/T]
GCTTTACAACAGAGGCCCGAAGACCGGTCCTTATGGTGGCCGAGGTGCTACTATCAAAACCATGCACCTCGAGCCCAACCTAAAACCATTTTGAGGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.60%	11.20%	8.38%	39.82%	NA
All Indica	2759	26.40%	5.30%	10.11%	58.25%	NA
All Japonica	1512	74.70%	22.90%	0.33%	1.98%	NA
Aus	269	6.30%	5.60%	23.79%	64.31%	NA
Indica I	595	20.80%	0.30%	2.86%	75.97%	NA
Indica II	465	23.70%	11.00%	20.65%	44.73%	NA
Indica III	913	32.00%	8.10%	8.76%	51.15%	NA
Indica Intermediate	786	25.60%	2.40%	10.94%	61.07%	NA
Temperate Japonica	767	73.80%	25.90%	0.13%	0.13%	NA
Tropical Japonica	504	70.40%	25.20%	0.40%	3.97%	NA
Japonica Intermediate	241	86.70%	8.70%	0.83%	3.73%	NA
VI/Aromatic	96	7.30%	12.50%	37.50%	42.71%	NA
Intermediate	90	40.00%	12.20%	13.33%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405463763	T -> DEL	N	N	silent_mutation	Average:35.264; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0405463763	T -> A	LOC_Os04g10120.1	upstream_gene_variant ; 101.0bp to feature; MODIFIER	silent_mutation	Average:35.264; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0405463763	T -> A	LOC_Os04g10110.1	downstream_gene_variant ; 1967.0bp to feature; MODIFIER	silent_mutation	Average:35.264; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0405463763	T -> A	LOC_Os04g10130.1	downstream_gene_variant ; 4094.0bp to feature; MODIFIER	silent_mutation	Average:35.264; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0405463763	T -> A	LOC_Os04g10110-LOC_Os04g10120	intergenic_region ; MODIFIER	silent_mutation	Average:35.264; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405463763	1.21E-06	NA	Plant_height	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405463763	9.61E-06	5.79E-17	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	6.61E-06	1.14E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	7.03E-07	1.09E-18	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	7.38E-06	2.16E-09	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	3.76E-07	5.80E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	1.82E-07	1.82E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	7.81E-06	1.97E-15	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	4.08E-07	1.55E-08	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	1.11E-06	1.11E-06	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	1.59E-07	2.32E-17	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	2.22E-06	2.14E-08	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	1.99E-11	3.87E-25	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	1.60E-09	4.03E-12	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	1.41E-06	1.43E-06	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	2.44E-07	2.44E-07	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	3.72E-08	3.66E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463763	4.80E-09	4.11E-12	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251