\
| Variant ID: vg0405463422 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5463422 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, G: 0.45, others allele: 0.00, population size: 88. )
CTAGTTTATAAAATTATTTTGGTTTAAATTACTGCGTTATCGCTTTATTTAAATTCCCGCGTTATCACTATTTTATTTAGCCATGCCTATTTACCTTTGT[G/T]
ATGACCTTATTATCATTGCTATTGTTATTATCACCTTGCTTACCCTAGGCAAATAAAACCCCGACTAGTGGGTACTCTATTCATGGTTCCACTAGTATGA
TCATACTAGTGGAACCATGAATAGAGTACCCACTAGTCGGGGTTTTATTTGCCTAGGGTAAGCAAGGTGATAATAACAATAGCAATGATAATAAGGTCAT[C/A]
ACAAAGGTAAATAGGCATGGCTAAATAAAATAGTGATAACGCGGGAATTTAAATAAAGCGATAACGCAGTAATTTAAACCAAAATAATTTTATAAACTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.50% | 7.00% | 17.25% | 35.27% | NA |
| All Indica | 2759 | 26.10% | 3.70% | 16.27% | 53.93% | NA |
| All Japonica | 1512 | 75.30% | 12.60% | 10.45% | 1.65% | NA |
| Aus | 269 | 5.60% | 5.60% | 56.13% | 32.71% | NA |
| Indica I | 595 | 19.50% | 0.70% | 5.38% | 74.45% | NA |
| Indica II | 465 | 23.90% | 8.00% | 29.25% | 38.92% | NA |
| Indica III | 913 | 32.10% | 4.40% | 15.88% | 47.65% | NA |
| Indica Intermediate | 786 | 25.30% | 2.80% | 17.30% | 54.58% | NA |
| Temperate Japonica | 767 | 74.40% | 7.40% | 17.99% | 0.13% | NA |
| Tropical Japonica | 504 | 70.80% | 23.20% | 2.58% | 3.37% | NA |
| Japonica Intermediate | 241 | 87.60% | 6.60% | 2.90% | 2.90% | NA |
| VI/Aromatic | 96 | 5.20% | 13.50% | 39.58% | 41.67% | NA |
| Intermediate | 90 | 40.00% | 10.00% | 21.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405463422 | G -> DEL | N | N | silent_mutation | Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg0405463422 | G -> T | LOC_Os04g10120.1 | upstream_gene_variant ; 442.0bp to feature; MODIFIER | silent_mutation | Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg0405463422 | G -> T | LOC_Os04g10110.1 | downstream_gene_variant ; 1626.0bp to feature; MODIFIER | silent_mutation | Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg0405463422 | G -> T | LOC_Os04g10130.1 | downstream_gene_variant ; 4435.0bp to feature; MODIFIER | silent_mutation | Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg0405463422 | G -> T | LOC_Os04g10110-LOC_Os04g10120 | intergenic_region ; MODIFIER | silent_mutation | Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405463422 | 4.36E-07 | NA | Plant_height | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0405463422 | 1.38E-06 | 2.25E-18 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 6.61E-06 | 1.14E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 5.50E-07 | 2.33E-19 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 7.38E-06 | 2.16E-09 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 3.66E-07 | 8.28E-06 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 1.82E-07 | 1.82E-07 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 8.55E-07 | 9.44E-17 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 4.08E-07 | 1.55E-08 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 1.11E-06 | 1.11E-06 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 3.72E-08 | 2.13E-18 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 2.22E-06 | 2.14E-08 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 1.74E-10 | 8.17E-25 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 1.60E-09 | 4.03E-12 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 1.49E-06 | 1.52E-06 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 2.44E-07 | 2.44E-07 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 2.94E-09 | 1.34E-31 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405463422 | 4.80E-09 | 4.11E-12 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |