Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405463422:

Variant ID: vg0405463422 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5463422
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, G: 0.45, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGTTTATAAAATTATTTTGGTTTAAATTACTGCGTTATCGCTTTATTTAAATTCCCGCGTTATCACTATTTTATTTAGCCATGCCTATTTACCTTTGT[G/T]
ATGACCTTATTATCATTGCTATTGTTATTATCACCTTGCTTACCCTAGGCAAATAAAACCCCGACTAGTGGGTACTCTATTCATGGTTCCACTAGTATGA

Reverse complement sequence

TCATACTAGTGGAACCATGAATAGAGTACCCACTAGTCGGGGTTTTATTTGCCTAGGGTAAGCAAGGTGATAATAACAATAGCAATGATAATAAGGTCAT[C/A]
ACAAAGGTAAATAGGCATGGCTAAATAAAATAGTGATAACGCGGGAATTTAAATAAAGCGATAACGCAGTAATTTAAACCAAAATAATTTTATAAACTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	7.00%	17.25%	35.27%	NA
All Indica	2759	26.10%	3.70%	16.27%	53.93%	NA
All Japonica	1512	75.30%	12.60%	10.45%	1.65%	NA
Aus	269	5.60%	5.60%	56.13%	32.71%	NA
Indica I	595	19.50%	0.70%	5.38%	74.45%	NA
Indica II	465	23.90%	8.00%	29.25%	38.92%	NA
Indica III	913	32.10%	4.40%	15.88%	47.65%	NA
Indica Intermediate	786	25.30%	2.80%	17.30%	54.58%	NA
Temperate Japonica	767	74.40%	7.40%	17.99%	0.13%	NA
Tropical Japonica	504	70.80%	23.20%	2.58%	3.37%	NA
Japonica Intermediate	241	87.60%	6.60%	2.90%	2.90%	NA
VI/Aromatic	96	5.20%	13.50%	39.58%	41.67%	NA
Intermediate	90	40.00%	10.00%	21.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405463422	G -> DEL	N	N	silent_mutation	Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg0405463422	G -> T	LOC_Os04g10120.1	upstream_gene_variant ; 442.0bp to feature; MODIFIER	silent_mutation	Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg0405463422	G -> T	LOC_Os04g10110.1	downstream_gene_variant ; 1626.0bp to feature; MODIFIER	silent_mutation	Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg0405463422	G -> T	LOC_Os04g10130.1	downstream_gene_variant ; 4435.0bp to feature; MODIFIER	silent_mutation	Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N
vg0405463422	G -> T	LOC_Os04g10110-LOC_Os04g10120	intergenic_region ; MODIFIER	silent_mutation	Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405463422	4.36E-07	NA	Plant_height	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405463422	1.38E-06	2.25E-18	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	6.61E-06	1.14E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	5.50E-07	2.33E-19	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	7.38E-06	2.16E-09	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	3.66E-07	8.28E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	1.82E-07	1.82E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	8.55E-07	9.44E-17	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	4.08E-07	1.55E-08	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	1.11E-06	1.11E-06	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	3.72E-08	2.13E-18	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	2.22E-06	2.14E-08	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	1.74E-10	8.17E-25	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	1.60E-09	4.03E-12	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	1.49E-06	1.52E-06	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	2.44E-07	2.44E-07	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	2.94E-09	1.34E-31	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422	4.80E-09	4.11E-12	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251