\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405463422:

Variant ID: vg0405463422 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5463422
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, G: 0.45, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGTTTATAAAATTATTTTGGTTTAAATTACTGCGTTATCGCTTTATTTAAATTCCCGCGTTATCACTATTTTATTTAGCCATGCCTATTTACCTTTGT[G/T]
ATGACCTTATTATCATTGCTATTGTTATTATCACCTTGCTTACCCTAGGCAAATAAAACCCCGACTAGTGGGTACTCTATTCATGGTTCCACTAGTATGA

Reverse complement sequence

TCATACTAGTGGAACCATGAATAGAGTACCCACTAGTCGGGGTTTTATTTGCCTAGGGTAAGCAAGGTGATAATAACAATAGCAATGATAATAAGGTCAT[C/A]
ACAAAGGTAAATAGGCATGGCTAAATAAAATAGTGATAACGCGGGAATTTAAATAAAGCGATAACGCAGTAATTTAAACCAAAATAATTTTATAAACTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 7.00% 17.25% 35.27% NA
All Indica  2759 26.10% 3.70% 16.27% 53.93% NA
All Japonica  1512 75.30% 12.60% 10.45% 1.65% NA
Aus  269 5.60% 5.60% 56.13% 32.71% NA
Indica I  595 19.50% 0.70% 5.38% 74.45% NA
Indica II  465 23.90% 8.00% 29.25% 38.92% NA
Indica III  913 32.10% 4.40% 15.88% 47.65% NA
Indica Intermediate  786 25.30% 2.80% 17.30% 54.58% NA
Temperate Japonica  767 74.40% 7.40% 17.99% 0.13% NA
Tropical Japonica  504 70.80% 23.20% 2.58% 3.37% NA
Japonica Intermediate  241 87.60% 6.60% 2.90% 2.90% NA
VI/Aromatic  96 5.20% 13.50% 39.58% 41.67% NA
Intermediate  90 40.00% 10.00% 21.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405463422 G -> DEL N N silent_mutation Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg0405463422 G -> T LOC_Os04g10120.1 upstream_gene_variant ; 442.0bp to feature; MODIFIER silent_mutation Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg0405463422 G -> T LOC_Os04g10110.1 downstream_gene_variant ; 1626.0bp to feature; MODIFIER silent_mutation Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg0405463422 G -> T LOC_Os04g10130.1 downstream_gene_variant ; 4435.0bp to feature; MODIFIER silent_mutation Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg0405463422 G -> T LOC_Os04g10110-LOC_Os04g10120 intergenic_region ; MODIFIER silent_mutation Average:23.775; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405463422 4.36E-07 NA Plant_height All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405463422 1.38E-06 2.25E-18 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 6.61E-06 1.14E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 5.50E-07 2.33E-19 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 7.38E-06 2.16E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 3.66E-07 8.28E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 1.82E-07 1.82E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 8.55E-07 9.44E-17 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 4.08E-07 1.55E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 1.11E-06 1.11E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 3.72E-08 2.13E-18 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 2.22E-06 2.14E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 1.74E-10 8.17E-25 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 1.60E-09 4.03E-12 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 1.49E-06 1.52E-06 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 2.44E-07 2.44E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 2.94E-09 1.34E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405463422 4.80E-09 4.11E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251