\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405459967:

Variant ID: vg0405459967 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5459967
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.12, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTAAGCTAGGCGGAAAGAAAAGAGAAAGAGAATCTATTACTATACTTCTAATACACATAGTATACATATATTCTAGTTAACTGAAATACTAGCTAATA[G/C]
CCTCTATCTGATGCCCTCCTAGTACTTCGAGAAGCCACCGCTGACTGCCGAGTTCCTTACGACAGCCCGTCATGACTATCCAACCGGGGCTAAATACAGA

Reverse complement sequence

TCTGTATTTAGCCCCGGTTGGATAGTCATGACGGGCTGTCGTAAGGAACTCGGCAGTCAGCGGTGGCTTCTCGAAGTACTAGGAGGGCATCAGATAGAGG[C/G]
TATTAGCTAGTATTTCAGTTAACTAGAATATATGTATACTATGTGTATTAGAAGTATAGTAATAGATTCTCTTTCTCTTTTCTTTCCGCCTAGCTTACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.00% 18.30% 4.95% 36.73% NA
All Indica  2759 25.50% 15.70% 3.19% 55.60% NA
All Japonica  1512 75.00% 14.80% 8.33% 1.85% NA
Aus  269 5.60% 45.00% 3.72% 45.72% NA
Indica I  595 19.70% 1.70% 1.34% 77.31% NA
Indica II  465 22.20% 35.30% 7.10% 35.48% NA
Indica III  913 31.20% 15.00% 3.29% 50.49% NA
Indica Intermediate  786 25.20% 15.60% 2.16% 57.00% NA
Temperate Japonica  767 74.20% 11.60% 14.21% 0.00% NA
Tropical Japonica  504 70.40% 22.40% 2.58% 4.56% NA
Japonica Intermediate  241 87.10% 9.10% 1.66% 2.07% NA
VI/Aromatic  96 5.20% 60.40% 4.17% 30.21% NA
Intermediate  90 38.90% 30.00% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405459967 G -> C LOC_Os04g10100.1 upstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0405459967 G -> C LOC_Os04g10110.1 upstream_gene_variant ; 644.0bp to feature; MODIFIER silent_mutation Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0405459967 G -> C LOC_Os04g10120.1 upstream_gene_variant ; 3897.0bp to feature; MODIFIER silent_mutation Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0405459967 G -> C LOC_Os04g10100-LOC_Os04g10110 intergenic_region ; MODIFIER silent_mutation Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N
vg0405459967 G -> DEL N N silent_mutation Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405459967 4.39E-06 1.78E-13 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 5.82E-06 1.00E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 7.78E-06 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 2.28E-06 1.42E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 NA 6.53E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 1.34E-07 1.34E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 NA 2.54E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 1.62E-06 5.38E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 8.46E-07 8.46E-07 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 1.15E-06 9.05E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 1.26E-07 8.89E-10 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 8.48E-07 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 2.02E-08 1.89E-10 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 5.10E-07 5.10E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 1.51E-08 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967 4.69E-10 2.98E-13 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251