Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405459967:

Variant ID: vg0405459967 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5459967
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.12, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAGCTAGGCGGAAAGAAAAGAGAAAGAGAATCTATTACTATACTTCTAATACACATAGTATACATATATTCTAGTTAACTGAAATACTAGCTAATA[G/C]
CCTCTATCTGATGCCCTCCTAGTACTTCGAGAAGCCACCGCTGACTGCCGAGTTCCTTACGACAGCCCGTCATGACTATCCAACCGGGGCTAAATACAGA

Reverse complement sequence

TCTGTATTTAGCCCCGGTTGGATAGTCATGACGGGCTGTCGTAAGGAACTCGGCAGTCAGCGGTGGCTTCTCGAAGTACTAGGAGGGCATCAGATAGAGG[C/G]
TATTAGCTAGTATTTCAGTTAACTAGAATATATGTATACTATGTGTATTAGAAGTATAGTAATAGATTCTCTTTCTCTTTTCTTTCCGCCTAGCTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.00%	18.30%	4.95%	36.73%	NA
All Indica	2759	25.50%	15.70%	3.19%	55.60%	NA
All Japonica	1512	75.00%	14.80%	8.33%	1.85%	NA
Aus	269	5.60%	45.00%	3.72%	45.72%	NA
Indica I	595	19.70%	1.70%	1.34%	77.31%	NA
Indica II	465	22.20%	35.30%	7.10%	35.48%	NA
Indica III	913	31.20%	15.00%	3.29%	50.49%	NA
Indica Intermediate	786	25.20%	15.60%	2.16%	57.00%	NA
Temperate Japonica	767	74.20%	11.60%	14.21%	0.00%	NA
Tropical Japonica	504	70.40%	22.40%	2.58%	4.56%	NA
Japonica Intermediate	241	87.10%	9.10%	1.66%	2.07%	NA
VI/Aromatic	96	5.20%	60.40%	4.17%	30.21%	NA
Intermediate	90	38.90%	30.00%	6.67%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405459967	G -> C	LOC_Os04g10100.1	upstream_gene_variant ; 2956.0bp to feature; MODIFIER	silent_mutation	Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0405459967	G -> C	LOC_Os04g10110.1	upstream_gene_variant ; 644.0bp to feature; MODIFIER	silent_mutation	Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0405459967	G -> C	LOC_Os04g10120.1	upstream_gene_variant ; 3897.0bp to feature; MODIFIER	silent_mutation	Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0405459967	G -> C	LOC_Os04g10100-LOC_Os04g10110	intergenic_region ; MODIFIER	silent_mutation	Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0405459967	G -> DEL	N	N	silent_mutation	Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405459967	4.39E-06	1.78E-13	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	5.82E-06	1.00E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	7.78E-06	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	2.28E-06	1.42E-09	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	NA	6.53E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	1.34E-07	1.34E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	NA	2.54E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	1.62E-06	5.38E-08	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	8.46E-07	8.46E-07	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	1.15E-06	9.05E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	1.26E-07	8.89E-10	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	8.48E-07	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	2.02E-08	1.89E-10	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	5.10E-07	5.10E-07	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	1.51E-08	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405459967	4.69E-10	2.98E-13	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251