\
| Variant ID: vg0405459967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5459967 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.12, others allele: 0.00, population size: 78. )
ATGTAAGCTAGGCGGAAAGAAAAGAGAAAGAGAATCTATTACTATACTTCTAATACACATAGTATACATATATTCTAGTTAACTGAAATACTAGCTAATA[G/C]
CCTCTATCTGATGCCCTCCTAGTACTTCGAGAAGCCACCGCTGACTGCCGAGTTCCTTACGACAGCCCGTCATGACTATCCAACCGGGGCTAAATACAGA
TCTGTATTTAGCCCCGGTTGGATAGTCATGACGGGCTGTCGTAAGGAACTCGGCAGTCAGCGGTGGCTTCTCGAAGTACTAGGAGGGCATCAGATAGAGG[C/G]
TATTAGCTAGTATTTCAGTTAACTAGAATATATGTATACTATGTGTATTAGAAGTATAGTAATAGATTCTCTTTCTCTTTTCTTTCCGCCTAGCTTACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.00% | 18.30% | 4.95% | 36.73% | NA |
| All Indica | 2759 | 25.50% | 15.70% | 3.19% | 55.60% | NA |
| All Japonica | 1512 | 75.00% | 14.80% | 8.33% | 1.85% | NA |
| Aus | 269 | 5.60% | 45.00% | 3.72% | 45.72% | NA |
| Indica I | 595 | 19.70% | 1.70% | 1.34% | 77.31% | NA |
| Indica II | 465 | 22.20% | 35.30% | 7.10% | 35.48% | NA |
| Indica III | 913 | 31.20% | 15.00% | 3.29% | 50.49% | NA |
| Indica Intermediate | 786 | 25.20% | 15.60% | 2.16% | 57.00% | NA |
| Temperate Japonica | 767 | 74.20% | 11.60% | 14.21% | 0.00% | NA |
| Tropical Japonica | 504 | 70.40% | 22.40% | 2.58% | 4.56% | NA |
| Japonica Intermediate | 241 | 87.10% | 9.10% | 1.66% | 2.07% | NA |
| VI/Aromatic | 96 | 5.20% | 60.40% | 4.17% | 30.21% | NA |
| Intermediate | 90 | 38.90% | 30.00% | 6.67% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405459967 | G -> C | LOC_Os04g10100.1 | upstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0405459967 | G -> C | LOC_Os04g10110.1 | upstream_gene_variant ; 644.0bp to feature; MODIFIER | silent_mutation | Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0405459967 | G -> C | LOC_Os04g10120.1 | upstream_gene_variant ; 3897.0bp to feature; MODIFIER | silent_mutation | Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0405459967 | G -> C | LOC_Os04g10100-LOC_Os04g10110 | intergenic_region ; MODIFIER | silent_mutation | Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0405459967 | G -> DEL | N | N | silent_mutation | Average:36.481; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405459967 | 4.39E-06 | 1.78E-13 | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 5.82E-06 | 1.00E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 7.78E-06 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 2.28E-06 | 1.42E-09 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | NA | 6.53E-06 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 1.34E-07 | 1.34E-07 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | NA | 2.54E-11 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 1.62E-06 | 5.38E-08 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 8.46E-07 | 8.46E-07 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 1.15E-06 | 9.05E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 1.26E-07 | 8.89E-10 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 8.48E-07 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 2.02E-08 | 1.89E-10 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 5.10E-07 | 5.10E-07 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 1.51E-08 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405459967 | 4.69E-10 | 2.98E-13 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |