\
| Variant ID: vg0405445291 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5445291 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 227. )
CCCAGAAATTCCTTTCTGGAGATCGATTTTACAGGAATCGTGAAAACCAAGAAATGTACTCAAGCCTTTCCATGTGAGCGTGAACTCCTTACGAAAAAAG[C/T]
GAAAAGAAATACCATCTTCTATTTCTTTCAAAGTGCACAGAAATTGCAAAGTACGCAAAGGAGAACCAGGCTCATCTACCACAGCAAATCTCTGCCAACC
GGTTGGCAGAGATTTGCTGTGGTAGATGAGCCTGGTTCTCCTTTGCGTACTTTGCAATTTCTGTGCACTTTGAAAGAAATAGAAGATGGTATTTCTTTTC[G/A]
CTTTTTTCGTAAGGAGTTCACGCTCACATGGAAAGGCTTGAGTACATTTCTTGGTTTTCACGATTCCTGTAAAATCGATCTCCAGAAAGGAATTTCTGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 8.20% | 4.87% | 29.16% | NA |
| All Indica | 2759 | 47.20% | 1.00% | 7.87% | 43.89% | NA |
| All Japonica | 1512 | 76.20% | 22.50% | 0.00% | 1.32% | NA |
| Aus | 269 | 56.10% | 0.00% | 2.23% | 41.64% | NA |
| Indica I | 595 | 27.10% | 0.00% | 8.57% | 64.37% | NA |
| Indica II | 465 | 68.60% | 0.20% | 3.66% | 27.53% | NA |
| Indica III | 913 | 49.30% | 2.60% | 9.64% | 38.44% | NA |
| Indica Intermediate | 786 | 47.50% | 0.40% | 7.76% | 44.40% | NA |
| Temperate Japonica | 767 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.80% | 24.00% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 89.60% | 8.70% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 66.70% | 8.30% | 4.17% | 20.83% | NA |
| Intermediate | 90 | 68.90% | 11.10% | 3.33% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405445291 | C -> DEL | LOC_Os04g10080.1 | N | frameshift_variant | Average:18.943; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
| vg0405445291 | C -> T | LOC_Os04g10080.1 | missense_variant ; p.Arg46His; MODERATE | nonsynonymous_codon ; R46H | Average:18.943; most accessible tissue: Minghui63 young leaf, score: 32.638 | benign |
0.124 |
TOLERATED | 0.19 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405445291 | 6.55E-07 | NA | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 5.90E-06 | 1.03E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 1.43E-09 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 6.92E-06 | 3.84E-10 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 4.21E-10 | 5.97E-11 | mr1525 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 3.21E-08 | 3.21E-08 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 8.63E-08 | NA | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 7.34E-07 | 2.97E-08 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 3.55E-06 | NA | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 1.75E-06 | 1.75E-06 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 1.35E-08 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 2.04E-06 | 3.79E-08 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 1.64E-14 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 1.56E-09 | 9.12E-13 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 5.33E-11 | 5.34E-11 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 8.17E-08 | 8.17E-08 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 1.23E-12 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405445291 | 1.55E-09 | 6.10E-13 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |