\
| Variant ID: vg0405444484 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 5444484 |
| Reference Allele: A | Alternative Allele: G,ATG |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 195. )
CAAGTCCCAACGAGAGGAACTCGAGCGCCATTCACTTGGAGATGGAGGCACACCACTTGATCTGGAGGGTTGGTTGTCCCCCCAGTGGATGTCATGAGGC[A/G,ATG]
CATGCCACCGGTCCTCACTGGCGCTTAACCAGGTTGAGACTCCGATGCTATGGCGTGGCGCTTGGGTCCATCCGGGTGCATCCCCAGTTGGTGCCCAACC
GGTTGGGCACCAACTGGGGATGCACCCGGATGGACCCAAGCGCCACGCCATAGCATCGGAGTCTCAACCTGGTTAAGCGCCAGTGAGGACCGGTGGCATG[T/C,CAT]
GCCTCATGACATCCACTGGGGGGACAACCAACCCTCCAGATCAAGTGGTGTGCCTCCATCTCCAAGTGAATGGCGCTCGAGTTCCTCTCGTTGGGACTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.50% | 31.50% | 7.68% | 25.12% | ATG: 1.16% |
| All Indica | 2759 | 17.00% | 31.10% | 10.26% | 40.20% | ATG: 1.38% |
| All Japonica | 1512 | 72.30% | 26.30% | 0.60% | 0.79% | NA |
| Aus | 269 | 10.00% | 48.70% | 17.84% | 17.10% | ATG: 6.32% |
| Indica I | 595 | 25.50% | 2.00% | 15.46% | 56.13% | ATG: 0.84% |
| Indica II | 465 | 19.40% | 48.80% | 3.66% | 27.53% | ATG: 0.65% |
| Indica III | 913 | 7.90% | 43.80% | 7.67% | 38.34% | ATG: 2.30% |
| Indica Intermediate | 786 | 19.80% | 28.00% | 13.23% | 37.79% | ATG: 1.15% |
| Temperate Japonica | 767 | 72.50% | 27.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 66.10% | 30.60% | 1.79% | 1.59% | NA |
| Japonica Intermediate | 241 | 84.60% | 13.70% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 12.50% | 63.50% | 14.58% | 9.38% | NA |
| Intermediate | 90 | 31.10% | 46.70% | 10.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405444484 | A -> ATG | LOC_Os04g10080.1 | frameshift_variant ; p.Val315fs; HIGH | frameshift_variant | Average:34.39; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg0405444484 | A -> DEL | LOC_Os04g10080.1 | N | frameshift_variant | Average:34.39; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg0405444484 | A -> G | LOC_Os04g10080.1 | missense_variant ; p.Val315Ala; MODERATE | nonsynonymous_codon ; V315A | Average:34.39; most accessible tissue: Minghui63 young leaf, score: 72.959 | benign |
-0.593 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405444484 | 3.71E-07 | 3.24E-16 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 1.01E-06 | 2.73E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | NA | 2.30E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 1.28E-06 | 1.28E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 1.42E-07 | 1.21E-16 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 2.71E-07 | 9.19E-09 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 7.25E-08 | NA | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 1.36E-07 | 1.36E-07 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 4.65E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 5.32E-08 | 7.99E-10 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 2.57E-09 | 3.28E-21 | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 1.49E-08 | 2.91E-11 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 6.09E-07 | 6.14E-07 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 6.10E-08 | 6.10E-08 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 1.24E-07 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405444484 | 2.18E-11 | 5.73E-14 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |