\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405444484:

Variant ID: vg0405444484 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 5444484
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTCCCAACGAGAGGAACTCGAGCGCCATTCACTTGGAGATGGAGGCACACCACTTGATCTGGAGGGTTGGTTGTCCCCCCAGTGGATGTCATGAGGC[A/G,ATG]
CATGCCACCGGTCCTCACTGGCGCTTAACCAGGTTGAGACTCCGATGCTATGGCGTGGCGCTTGGGTCCATCCGGGTGCATCCCCAGTTGGTGCCCAACC

Reverse complement sequence

GGTTGGGCACCAACTGGGGATGCACCCGGATGGACCCAAGCGCCACGCCATAGCATCGGAGTCTCAACCTGGTTAAGCGCCAGTGAGGACCGGTGGCATG[T/C,CAT]
GCCTCATGACATCCACTGGGGGGACAACCAACCCTCCAGATCAAGTGGTGTGCCTCCATCTCCAAGTGAATGGCGCTCGAGTTCCTCTCGTTGGGACTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.50% 31.50% 7.68% 25.12% ATG: 1.16%
All Indica  2759 17.00% 31.10% 10.26% 40.20% ATG: 1.38%
All Japonica  1512 72.30% 26.30% 0.60% 0.79% NA
Aus  269 10.00% 48.70% 17.84% 17.10% ATG: 6.32%
Indica I  595 25.50% 2.00% 15.46% 56.13% ATG: 0.84%
Indica II  465 19.40% 48.80% 3.66% 27.53% ATG: 0.65%
Indica III  913 7.90% 43.80% 7.67% 38.34% ATG: 2.30%
Indica Intermediate  786 19.80% 28.00% 13.23% 37.79% ATG: 1.15%
Temperate Japonica  767 72.50% 27.50% 0.00% 0.00% NA
Tropical Japonica  504 66.10% 30.60% 1.79% 1.59% NA
Japonica Intermediate  241 84.60% 13.70% 0.00% 1.66% NA
VI/Aromatic  96 12.50% 63.50% 14.58% 9.38% NA
Intermediate  90 31.10% 46.70% 10.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405444484 A -> ATG LOC_Os04g10080.1 frameshift_variant ; p.Val315fs; HIGH frameshift_variant Average:34.39; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg0405444484 A -> DEL LOC_Os04g10080.1 N frameshift_variant Average:34.39; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg0405444484 A -> G LOC_Os04g10080.1 missense_variant ; p.Val315Ala; MODERATE nonsynonymous_codon ; V315A Average:34.39; most accessible tissue: Minghui63 young leaf, score: 72.959 benign -0.593 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405444484 3.71E-07 3.24E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 1.01E-06 2.73E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 NA 2.30E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 1.28E-06 1.28E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 1.42E-07 1.21E-16 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 2.71E-07 9.19E-09 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 7.25E-08 NA mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 1.36E-07 1.36E-07 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 4.65E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 5.32E-08 7.99E-10 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 2.57E-09 3.28E-21 mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 1.49E-08 2.91E-11 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 6.09E-07 6.14E-07 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 6.10E-08 6.10E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 1.24E-07 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405444484 2.18E-11 5.73E-14 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251