\
| Variant ID: vg0405442580 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5442580 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, A: 0.27, others allele: 0.00, population size: 204. )
TTTGTCATGTTAATTCTGAGTTCTTGGCCCATTCATACACAAGTCTGGTTCTCGACATCGTCCGATTGATTTATTGTTGGTGTTGATCTCGATTCTCCTC[A/C]
ACTTTATGATCATTCTCTGCAAAAGGTTAGTAGACCTAATACTAGTGGCATATTATTATTCTAAAATATTTATGCATTGCAAGCATCACTAGTTCTCTCT
AGAGAGAACTAGTGATGCTTGCAATGCATAAATATTTTAGAATAATAATATGCCACTAGTATTAGGTCTACTAACCTTTTGCAGAGAATGATCATAAAGT[T/G]
GAGGAGAATCGAGATCAACACCAACAATAAATCAATCGGACGATGTCGAGAACCAGACTTGTGTATGAATGGGCCAAGAACTCAGAATTAACATGACAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.80% | 23.30% | 0.32% | 42.59% | NA |
| All Indica | 2759 | 15.00% | 18.70% | 0.43% | 65.78% | NA |
| All Japonica | 1512 | 74.60% | 23.80% | 0.00% | 1.59% | NA |
| Aus | 269 | 5.90% | 48.00% | 0.37% | 45.72% | NA |
| Indica I | 595 | 22.50% | 2.00% | 0.17% | 75.29% | NA |
| Indica II | 465 | 18.30% | 44.10% | 0.43% | 37.20% | NA |
| Indica III | 913 | 6.40% | 16.40% | 0.44% | 76.78% | NA |
| Indica Intermediate | 786 | 17.60% | 19.10% | 0.64% | 62.72% | NA |
| Temperate Japonica | 767 | 73.40% | 26.30% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 70.80% | 25.60% | 0.00% | 3.57% | NA |
| Japonica Intermediate | 241 | 86.30% | 12.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 9.40% | 62.50% | 1.04% | 27.08% | NA |
| Intermediate | 90 | 31.10% | 40.00% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405442580 | A -> C | LOC_Os04g10070.1 | downstream_gene_variant ; 1207.0bp to feature; MODIFIER | silent_mutation | Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0405442580 | A -> C | LOC_Os04g10080.1 | downstream_gene_variant ; 1597.0bp to feature; MODIFIER | silent_mutation | Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0405442580 | A -> C | LOC_Os04g10090.1 | downstream_gene_variant ; 3714.0bp to feature; MODIFIER | silent_mutation | Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0405442580 | A -> C | LOC_Os04g10070-LOC_Os04g10080 | intergenic_region ; MODIFIER | silent_mutation | Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0405442580 | A -> DEL | N | N | silent_mutation | Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405442580 | 5.82E-06 | 7.92E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 3.15E-08 | 9.45E-18 | mr1062 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 2.43E-06 | 6.73E-10 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 1.05E-07 | 1.05E-07 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 3.81E-07 | 1.23E-08 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 1.04E-06 | 1.04E-06 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 3.01E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 5.68E-06 | 7.17E-08 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 1.69E-07 | 2.76E-19 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 5.96E-11 | 7.62E-14 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 7.47E-08 | 7.47E-08 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 8.85E-08 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405442580 | 1.67E-08 | 1.86E-11 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |