\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405442580:

Variant ID: vg0405442580 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5442580
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, A: 0.27, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTCATGTTAATTCTGAGTTCTTGGCCCATTCATACACAAGTCTGGTTCTCGACATCGTCCGATTGATTTATTGTTGGTGTTGATCTCGATTCTCCTC[A/C]
ACTTTATGATCATTCTCTGCAAAAGGTTAGTAGACCTAATACTAGTGGCATATTATTATTCTAAAATATTTATGCATTGCAAGCATCACTAGTTCTCTCT

Reverse complement sequence

AGAGAGAACTAGTGATGCTTGCAATGCATAAATATTTTAGAATAATAATATGCCACTAGTATTAGGTCTACTAACCTTTTGCAGAGAATGATCATAAAGT[T/G]
GAGGAGAATCGAGATCAACACCAACAATAAATCAATCGGACGATGTCGAGAACCAGACTTGTGTATGAATGGGCCAAGAACTCAGAATTAACATGACAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 23.30% 0.32% 42.59% NA
All Indica  2759 15.00% 18.70% 0.43% 65.78% NA
All Japonica  1512 74.60% 23.80% 0.00% 1.59% NA
Aus  269 5.90% 48.00% 0.37% 45.72% NA
Indica I  595 22.50% 2.00% 0.17% 75.29% NA
Indica II  465 18.30% 44.10% 0.43% 37.20% NA
Indica III  913 6.40% 16.40% 0.44% 76.78% NA
Indica Intermediate  786 17.60% 19.10% 0.64% 62.72% NA
Temperate Japonica  767 73.40% 26.30% 0.00% 0.26% NA
Tropical Japonica  504 70.80% 25.60% 0.00% 3.57% NA
Japonica Intermediate  241 86.30% 12.00% 0.00% 1.66% NA
VI/Aromatic  96 9.40% 62.50% 1.04% 27.08% NA
Intermediate  90 31.10% 40.00% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405442580 A -> C LOC_Os04g10070.1 downstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0405442580 A -> C LOC_Os04g10080.1 downstream_gene_variant ; 1597.0bp to feature; MODIFIER silent_mutation Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0405442580 A -> C LOC_Os04g10090.1 downstream_gene_variant ; 3714.0bp to feature; MODIFIER silent_mutation Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0405442580 A -> C LOC_Os04g10070-LOC_Os04g10080 intergenic_region ; MODIFIER silent_mutation Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0405442580 A -> DEL N N silent_mutation Average:21.625; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405442580 5.82E-06 7.92E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 3.15E-08 9.45E-18 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 2.43E-06 6.73E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 1.05E-07 1.05E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 3.81E-07 1.23E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 1.04E-06 1.04E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 3.01E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 5.68E-06 7.17E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 1.69E-07 2.76E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 5.96E-11 7.62E-14 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 7.47E-08 7.47E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 8.85E-08 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405442580 1.67E-08 1.86E-11 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251