\
| Variant ID: vg0405440340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5440340 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCTGCTGTAGCTGATGAATCCGAAGCCGATGAAGCAAAAAGATTGGCTCGGGGGAAGAGTGTTGTAACTGCATCGGTTAACATGGTTTTCACGTTACCT[G/T]
CTGAATTTGGAGCCAAACAAGCCGATGTCGATGAAGTTGAGGAAGCATCGGCTAGGTTGGTTTTGTCACCAGAGCAGGCGGTTTTTGAGAAACCATAGGG
CCCTATGGTTTCTCAAAAACCGCCTGCTCTGGTGACAAAACCAACCTAGCCGATGCTTCCTCAACTTCATCGACATCGGCTTGTTTGGCTCCAAATTCAG[C/A]
AGGTAACGTGAAAACCATGTTAACCGATGCAGTTACAACACTCTTCCCCCGAGCCAATCTTTTTGCTTCATCGGCTTCGGATTCATCAGCTACAGCAGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.20% | 8.30% | 5.01% | 41.45% | NA |
| All Indica | 2759 | 27.70% | 1.10% | 6.42% | 64.73% | NA |
| All Japonica | 1512 | 74.90% | 22.70% | 0.46% | 1.98% | NA |
| Aus | 269 | 62.80% | 0.00% | 8.92% | 28.25% | NA |
| Indica I | 595 | 26.40% | 0.00% | 6.39% | 67.23% | NA |
| Indica II | 465 | 29.20% | 0.20% | 6.88% | 63.66% | NA |
| Indica III | 913 | 22.60% | 2.80% | 6.35% | 68.24% | NA |
| Indica Intermediate | 786 | 33.80% | 0.50% | 6.23% | 59.41% | NA |
| Temperate Japonica | 767 | 73.50% | 25.40% | 0.65% | 0.39% | NA |
| Tropical Japonica | 504 | 71.20% | 25.20% | 0.40% | 3.17% | NA |
| Japonica Intermediate | 241 | 86.70% | 8.70% | 0.00% | 4.56% | NA |
| VI/Aromatic | 96 | 35.40% | 8.30% | 23.96% | 32.29% | NA |
| Intermediate | 90 | 40.00% | 13.30% | 6.67% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405440340 | G -> DEL | N | N | silent_mutation | Average:20.982; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| vg0405440340 | G -> T | LOC_Os04g10080.1 | downstream_gene_variant ; 3837.0bp to feature; MODIFIER | silent_mutation | Average:20.982; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| vg0405440340 | G -> T | LOC_Os04g10070.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.982; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405440340 | 2.67E-06 | NA | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | NA | 4.07E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 4.54E-06 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | NA | 5.68E-09 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | NA | 6.48E-07 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 1.47E-06 | 1.47E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 1.91E-08 | NA | mr1626 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 6.13E-07 | 3.18E-08 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 8.71E-06 | NA | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 4.67E-07 | 4.67E-07 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 5.15E-09 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 1.14E-06 | 1.09E-08 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 1.95E-10 | NA | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 8.10E-09 | 4.54E-11 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 3.44E-08 | 3.43E-08 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 1.82E-06 | 1.82E-06 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 2.62E-11 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405440340 | 6.88E-10 | 1.96E-13 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |