\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405437883:

Variant ID: vg0405437883 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5437883
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.48, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAGGTGGTAAAGGTGCTGCAGATGGCTCAGGAGATAAAGGTGATGGTTCTCAGGGGGTGCAAGGTGAGGATCTCAGCCTAGATGGTAATACAGCACAG[T/C]
TATAGTTTAATAACTTCCAAGATCGGATTGACTATGCTGTGCAACATGCTTTGATTAATTAATCTGGGGTGTTAGTTATTACCTTGTCAAATATGGTTAA

Reverse complement sequence

TTAACCATATTTGACAAGGTAATAACTAACACCCCAGATTAATTAATCAAAGCATGTTGCACAGCATAGTCAATCCGATCTTGGAAGTTATTAAACTATA[A/G]
CTGTGCTGTATTACCATCTAGGCTGAGATCCTCACCTTGCACCCCCTGAGAACCATCACCTTTATCTCCTGAGCCATCTGCAGCACCTTTACCACCTGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 17.00% 0.72% 48.92% NA
All Indica  2759 14.50% 8.50% 0.91% 76.11% NA
All Japonica  1512 74.70% 23.00% 0.00% 2.31% NA
Aus  269 4.50% 65.80% 2.23% 27.51% NA
Indica I  595 20.00% 2.00% 1.01% 76.97% NA
Indica II  465 18.70% 10.10% 0.86% 70.32% NA
Indica III  913 6.80% 9.60% 0.77% 82.80% NA
Indica Intermediate  786 16.70% 11.20% 1.02% 71.12% NA
Temperate Japonica  767 73.40% 26.10% 0.00% 0.52% NA
Tropical Japonica  504 70.80% 25.20% 0.00% 3.97% NA
Japonica Intermediate  241 86.70% 8.70% 0.00% 4.56% NA
VI/Aromatic  96 8.30% 26.00% 0.00% 65.62% NA
Intermediate  90 32.20% 20.00% 3.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405437883 T -> C LOC_Os04g10060.1 upstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:34.524; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0405437883 T -> C LOC_Os04g10070.1 intron_variant ; MODIFIER silent_mutation Average:34.524; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0405437883 T -> DEL N N silent_mutation Average:34.524; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405437883 NA 4.38E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 1.93E-07 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 NA 3.19E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 NA 4.29E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 5.62E-07 5.62E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 4.73E-07 3.28E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 1.69E-06 1.69E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 7.92E-07 9.54E-09 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 3.39E-08 NA mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 1.56E-08 1.37E-10 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 3.20E-06 3.20E-06 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 8.61E-07 8.61E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 4.79E-07 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883 6.26E-10 2.06E-13 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251