Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405437883:

Variant ID: vg0405437883 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5437883
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.48, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATCAGGTGGTAAAGGTGCTGCAGATGGCTCAGGAGATAAAGGTGATGGTTCTCAGGGGGTGCAAGGTGAGGATCTCAGCCTAGATGGTAATACAGCACAG[T/C]
TATAGTTTAATAACTTCCAAGATCGGATTGACTATGCTGTGCAACATGCTTTGATTAATTAATCTGGGGTGTTAGTTATTACCTTGTCAAATATGGTTAA

Reverse complement sequence

TTAACCATATTTGACAAGGTAATAACTAACACCCCAGATTAATTAATCAAAGCATGTTGCACAGCATAGTCAATCCGATCTTGGAAGTTATTAAACTATA[A/G]
CTGTGCTGTATTACCATCTAGGCTGAGATCCTCACCTTGCACCCCCTGAGAACCATCACCTTTATCTCCTGAGCCATCTGCAGCACCTTTACCACCTGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.40%	17.00%	0.72%	48.92%	NA
All Indica	2759	14.50%	8.50%	0.91%	76.11%	NA
All Japonica	1512	74.70%	23.00%	0.00%	2.31%	NA
Aus	269	4.50%	65.80%	2.23%	27.51%	NA
Indica I	595	20.00%	2.00%	1.01%	76.97%	NA
Indica II	465	18.70%	10.10%	0.86%	70.32%	NA
Indica III	913	6.80%	9.60%	0.77%	82.80%	NA
Indica Intermediate	786	16.70%	11.20%	1.02%	71.12%	NA
Temperate Japonica	767	73.40%	26.10%	0.00%	0.52%	NA
Tropical Japonica	504	70.80%	25.20%	0.00%	3.97%	NA
Japonica Intermediate	241	86.70%	8.70%	0.00%	4.56%	NA
VI/Aromatic	96	8.30%	26.00%	0.00%	65.62%	NA
Intermediate	90	32.20%	20.00%	3.33%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405437883	T -> C	LOC_Os04g10060.1	upstream_gene_variant ; 3855.0bp to feature; MODIFIER	silent_mutation	Average:34.524; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0405437883	T -> C	LOC_Os04g10070.1	intron_variant ; MODIFIER	silent_mutation	Average:34.524; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0405437883	T -> DEL	N	N	silent_mutation	Average:34.524; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405437883	NA	4.38E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	1.93E-07	NA	mr1062	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	NA	3.19E-09	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	NA	4.29E-08	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	5.62E-07	5.62E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	4.73E-07	3.28E-08	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	1.69E-06	1.69E-06	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	7.92E-07	9.54E-09	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	3.39E-08	NA	mr1062_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	1.56E-08	1.37E-10	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	3.20E-06	3.20E-06	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	8.61E-07	8.61E-07	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	4.79E-07	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405437883	6.26E-10	2.06E-13	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251