\
| Variant ID: vg0405425386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5425386 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTCAAACTAATTAATAGATTGTACCCTCCATCCTAAAACCTAAAATATGAGTTCAAGCTAGCATTAAAAAAAAAATCTTAAGATATAACAAGATATC[C/T]
ACCTATATTCTCTTCTCAACCAATCATGACCAACCTAGTAAGTAAAGAAGTAAAATACATGTGATGTGTTTAAATGCTCTGCTCTGTTTATTATTTCATT
AATGAAATAATAAACAGAGCAGAGCATTTAAACACATCACATGTATTTTACTTCTTTACTTACTAGGTTGGTCATGATTGGTTGAGAAGAGAATATAGGT[G/A]
GATATCTTGTTATATCTTAAGATTTTTTTTTTAATGCTAGCTTGAACTCATATTTTAGGTTTTAGGATGGAGGGTACAATCTATTAATTAGTTTGAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 7.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.60% | 20.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 78.90% | 20.30% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 74.60% | 25.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405425386 | C -> T | LOC_Os04g10060.1 | downstream_gene_variant ; 2952.0bp to feature; MODIFIER | silent_mutation | Average:37.788; most accessible tissue: Zhenshan97 young leaf, score: 60.208 | N | N | N | N |
| vg0405425386 | C -> T | LOC_Os04g10050-LOC_Os04g10060 | intergenic_region ; MODIFIER | silent_mutation | Average:37.788; most accessible tissue: Zhenshan97 young leaf, score: 60.208 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405425386 | 7.80E-07 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | NA | 1.38E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 6.04E-07 | 5.16E-08 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 6.93E-06 | NA | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 1.58E-06 | NA | mr1013_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 6.38E-08 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 3.97E-06 | 4.84E-07 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 6.35E-07 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 9.66E-08 | 9.65E-08 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 6.36E-13 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405425386 | 7.59E-10 | 8.86E-12 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |