\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405425386:

Variant ID: vg0405425386 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5425386
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCAAACTAATTAATAGATTGTACCCTCCATCCTAAAACCTAAAATATGAGTTCAAGCTAGCATTAAAAAAAAAATCTTAAGATATAACAAGATATC[C/T]
ACCTATATTCTCTTCTCAACCAATCATGACCAACCTAGTAAGTAAAGAAGTAAAATACATGTGATGTGTTTAAATGCTCTGCTCTGTTTATTATTTCATT

Reverse complement sequence

AATGAAATAATAAACAGAGCAGAGCATTTAAACACATCACATGTATTTTACTTCTTTACTTACTAGGTTGGTCATGATTGGTTGAGAAGAGAATATAGGT[G/A]
GATATCTTGTTATATCTTAAGATTTTTTTTTTAATGCTAGCTTGAACTCATATTTTAGGTTTTAGGATGGAGGGTACAATCTATTAATTAGTTTGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.40% 0.13% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 79.60% 20.00% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 78.90% 20.30% 0.78% 0.00% NA
Tropical Japonica  504 74.60% 25.40% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405425386 C -> T LOC_Os04g10060.1 downstream_gene_variant ; 2952.0bp to feature; MODIFIER silent_mutation Average:37.788; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0405425386 C -> T LOC_Os04g10050-LOC_Os04g10060 intergenic_region ; MODIFIER silent_mutation Average:37.788; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405425386 7.80E-07 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 NA 1.38E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 6.04E-07 5.16E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 6.93E-06 NA mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 1.58E-06 NA mr1013_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 6.38E-08 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 3.97E-06 4.84E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 6.35E-07 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 9.66E-08 9.65E-08 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 6.36E-13 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405425386 7.59E-10 8.86E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251