Variant ID: vg0405387831 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 5387831 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 86. )
TGTTAAAGTCCTAAACTTTACACAGATGCTAATCATTTATATTTAATTATCATAACTTTATGAATCTCATAATGTGCTAGTCAAATCCTTCGGCGGTGCC[C/T]
ATAGTAATCATGGTTACTTCGTCAGTTTTAAGATATGCTAATCATTTTTTTATGTGCATATAGGGACAAAGTGTAAGTGTCTGCCATGCCCAATCTTTTG
CAAAAGATTGGGCATGGCAGACACTTACACTTTGTCCCTATATGCACATAAAAAAATGATTAGCATATCTTAAAACTGACGAAGTAACCATGATTACTAT[G/A]
GGCACCGCCGAAGGATTTGACTAGCACATTATGAGATTCATAAAGTTATGATAATTAAATATAAATGATTAGCATCTGTGTAAAGTTTAGGACTTTAACA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 58.60% | 41.10% | 0.23% | 0.00% | NA |
All Indica | 2759 | 37.60% | 62.20% | 0.25% | 0.00% | NA |
All Japonica | 1512 | 97.90% | 2.00% | 0.07% | 0.00% | NA |
Aus | 269 | 47.20% | 52.00% | 0.74% | 0.00% | NA |
Indica I | 595 | 8.70% | 91.10% | 0.17% | 0.00% | NA |
Indica II | 465 | 58.90% | 40.90% | 0.22% | 0.00% | NA |
Indica III | 913 | 45.10% | 54.50% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 38.00% | 61.70% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0405387831 | C -> T | LOC_Os04g10010.1 | upstream_gene_variant ; 616.0bp to feature; MODIFIER | silent_mutation | Average:42.91; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
vg0405387831 | C -> T | LOC_Os04g10020.1 | downstream_gene_variant ; 1015.0bp to feature; MODIFIER | silent_mutation | Average:42.91; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
vg0405387831 | C -> T | LOC_Os04g10010-LOC_Os04g10020 | intergenic_region ; MODIFIER | silent_mutation | Average:42.91; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0405387831 | NA | 2.09E-16 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 1.21E-10 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 3.50E-18 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 1.40E-12 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 3.98E-17 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 8.80E-11 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 1.22E-17 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 1.57E-11 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 1.40E-16 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405387831 | NA | 7.92E-11 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/