\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405387831:

Variant ID: vg0405387831 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5387831
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTAAAGTCCTAAACTTTACACAGATGCTAATCATTTATATTTAATTATCATAACTTTATGAATCTCATAATGTGCTAGTCAAATCCTTCGGCGGTGCC[C/T]
ATAGTAATCATGGTTACTTCGTCAGTTTTAAGATATGCTAATCATTTTTTTATGTGCATATAGGGACAAAGTGTAAGTGTCTGCCATGCCCAATCTTTTG

Reverse complement sequence

CAAAAGATTGGGCATGGCAGACACTTACACTTTGTCCCTATATGCACATAAAAAAATGATTAGCATATCTTAAAACTGACGAAGTAACCATGATTACTAT[G/A]
GGCACCGCCGAAGGATTTGACTAGCACATTATGAGATTCATAAAGTTATGATAATTAAATATAAATGATTAGCATCTGTGTAAAGTTTAGGACTTTAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 41.10% 0.23% 0.00% NA
All Indica  2759 37.60% 62.20% 0.25% 0.00% NA
All Japonica  1512 97.90% 2.00% 0.07% 0.00% NA
Aus  269 47.20% 52.00% 0.74% 0.00% NA
Indica I  595 8.70% 91.10% 0.17% 0.00% NA
Indica II  465 58.90% 40.90% 0.22% 0.00% NA
Indica III  913 45.10% 54.50% 0.33% 0.00% NA
Indica Intermediate  786 38.00% 61.70% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405387831 C -> T LOC_Os04g10010.1 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:42.91; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0405387831 C -> T LOC_Os04g10020.1 downstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:42.91; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0405387831 C -> T LOC_Os04g10010-LOC_Os04g10020 intergenic_region ; MODIFIER silent_mutation Average:42.91; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405387831 NA 2.09E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.21E-10 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 3.50E-18 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.40E-12 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 3.98E-17 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 8.80E-11 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.22E-17 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.57E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.40E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 7.92E-11 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 3.83E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.19E-09 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 6.25E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 6.79E-16 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.94E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.01E-18 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.47E-12 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 2.28E-20 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 2.48E-12 mr1167_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 6.35E-08 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 7.61E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 1.32E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387831 NA 2.64E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251