Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405387818:

Variant ID: vg0405387818 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5387818
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AACCAACCACGTGTGTTAAAGTCCTAAACTTTACACAGATGCTAATCATTTATATTTAATTATCATAACTTTATGAATCTCATAATGTGCTAGTCAAATC[C/T]
TTCGGCGGTGCCCATAGTAATCATGGTTACTTCGTCAGTTTTAAGATATGCTAATCATTTTTTTATGTGCATATAGGGACAAAGTGTAAGTGTCTGCCAT

Reverse complement sequence

ATGGCAGACACTTACACTTTGTCCCTATATGCACATAAAAAAATGATTAGCATATCTTAAAACTGACGAAGTAACCATGATTACTATGGGCACCGCCGAA[G/A]
GATTTGACTAGCACATTATGAGATTCATAAAGTTATGATAATTAAATATAAATGATTAGCATCTGTGTAAAGTTTAGGACTTTAACACACGTGGTTGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	8.10%	4.38%	5.69%	NA
All Indica	2759	87.70%	0.50%	2.07%	9.68%	NA
All Japonica	1512	66.30%	23.90%	9.72%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.00%	1.01%	0.00%	NA
Indica II	465	93.10%	2.20%	1.72%	3.01%	NA
Indica III	913	77.30%	0.00%	1.42%	21.25%	NA
Indica Intermediate	786	88.20%	0.50%	3.82%	7.51%	NA
Temperate Japonica	767	46.30%	41.70%	11.86%	0.13%	NA
Tropical Japonica	504	93.70%	2.40%	3.97%	0.00%	NA
Japonica Intermediate	241	73.00%	12.00%	14.94%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	7.80%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405387818	C -> DEL	N	N	silent_mutation	Average:45.607; most accessible tissue: Callus, score: 69.566	N	N	N	N
vg0405387818	C -> T	LOC_Os04g10010.1	upstream_gene_variant ; 603.0bp to feature; MODIFIER	silent_mutation	Average:45.607; most accessible tissue: Callus, score: 69.566	N	N	N	N
vg0405387818	C -> T	LOC_Os04g10020.1	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:45.607; most accessible tissue: Callus, score: 69.566	N	N	N	N
vg0405387818	C -> T	LOC_Os04g10010-LOC_Os04g10020	intergenic_region ; MODIFIER	silent_mutation	Average:45.607; most accessible tissue: Callus, score: 69.566	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405387818	NA	1.26E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405387818	NA	3.28E-11	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	3.43E-09	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	3.65E-06	1.25E-15	mr1182	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	7.31E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	3.15E-13	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	3.19E-07	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	2.52E-06	2.35E-14	mr1650	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	9.44E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	3.35E-11	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	4.70E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	1.59E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	7.28E-15	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	1.07E-10	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	1.63E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	4.10E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	2.21E-09	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	4.92E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	2.95E-15	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	8.72E-08	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	3.66E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	6.47E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818	NA	1.39E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251