\
| Variant ID: vg0405375041 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5375041 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 97. )
TGCATTCAATCCAATTAACGTAATATTGTTGGTATTTCTTAACGACATTACTAGAAATATAATTTCCAGCAATAACACATAAATACTTTTGGTATATTAT[A/G]
GTTACAGAGTTCATCCGTAAGCGTACGGATGTACCGTAGCATTTCACCTGAGAATATTCCAAGGGTATCGTATTTGTTTAATCCTGCGGGAAGATTATAA
TTATAATCTTCCCGCAGGATTAAACAAATACGATACCCTTGGAATATTCTCAGGTGAAATGCTACGGTACATCCGTACGCTTACGGATGAACTCTGTAAC[T/C]
ATAATATACCAAAAGTATTTATGTGTTATTGCTGGAAATTATATTTCTAGTAATGTCGTTAAGAAATACCAACAATATTACGTTAATTGGATTGAATGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 30.80% | 2.20% | 0.63% | NA |
| All Indica | 2759 | 90.60% | 8.30% | 0.98% | 0.18% | NA |
| All Japonica | 1512 | 15.20% | 78.40% | 4.89% | 1.46% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 94.80% | 4.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 84.30% | 11.60% | 3.66% | 0.43% | NA |
| Indica III | 913 | 93.60% | 6.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 11.30% | 0.76% | 0.38% | NA |
| Temperate Japonica | 767 | 19.80% | 72.10% | 6.13% | 1.96% | NA |
| Tropical Japonica | 504 | 11.70% | 83.90% | 3.57% | 0.79% | NA |
| Japonica Intermediate | 241 | 7.90% | 87.10% | 3.73% | 1.24% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 32.20% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405375041 | A -> DEL | N | N | silent_mutation | Average:67.046; most accessible tissue: Callus, score: 96.121 | N | N | N | N |
| vg0405375041 | A -> G | LOC_Os04g09990.1 | upstream_gene_variant ; 2221.0bp to feature; MODIFIER | silent_mutation | Average:67.046; most accessible tissue: Callus, score: 96.121 | N | N | N | N |
| vg0405375041 | A -> G | LOC_Os04g09980.1 | downstream_gene_variant ; 2507.0bp to feature; MODIFIER | silent_mutation | Average:67.046; most accessible tissue: Callus, score: 96.121 | N | N | N | N |
| vg0405375041 | A -> G | LOC_Os04g09980-LOC_Os04g09990 | intergenic_region ; MODIFIER | silent_mutation | Average:67.046; most accessible tissue: Callus, score: 96.121 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405375041 | 1.63E-14 | 2.24E-29 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 5.89E-07 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 1.26E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 7.26E-13 | 9.22E-27 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 8.81E-09 | 9.98E-14 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 7.78E-11 | NA | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 6.93E-09 | 6.93E-09 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 2.83E-13 | 1.80E-24 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 5.57E-06 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 2.75E-07 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 1.10E-09 | 2.64E-36 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 9.47E-06 | 1.59E-06 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 5.83E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 1.16E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 1.78E-06 | 1.78E-06 | mr1726 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 3.54E-11 | 3.83E-23 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 2.68E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 4.15E-23 | 1.69E-36 | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 1.21E-06 | NA | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 2.85E-14 | 2.24E-18 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 5.58E-19 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 3.96E-08 | 3.96E-08 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | 7.41E-09 | 5.33E-40 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 5.77E-07 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405375041 | NA | 1.77E-14 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |