\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405375041:

Variant ID: vg0405375041 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5375041
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATTCAATCCAATTAACGTAATATTGTTGGTATTTCTTAACGACATTACTAGAAATATAATTTCCAGCAATAACACATAAATACTTTTGGTATATTAT[A/G]
GTTACAGAGTTCATCCGTAAGCGTACGGATGTACCGTAGCATTTCACCTGAGAATATTCCAAGGGTATCGTATTTGTTTAATCCTGCGGGAAGATTATAA

Reverse complement sequence

TTATAATCTTCCCGCAGGATTAAACAAATACGATACCCTTGGAATATTCTCAGGTGAAATGCTACGGTACATCCGTACGCTTACGGATGAACTCTGTAAC[T/C]
ATAATATACCAAAAGTATTTATGTGTTATTGCTGGAAATTATATTTCTAGTAATGTCGTTAAGAAATACCAACAATATTACGTTAATTGGATTGAATGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 30.80% 2.20% 0.63% NA
All Indica  2759 90.60% 8.30% 0.98% 0.18% NA
All Japonica  1512 15.20% 78.40% 4.89% 1.46% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 94.80% 4.70% 0.50% 0.00% NA
Indica II  465 84.30% 11.60% 3.66% 0.43% NA
Indica III  913 93.60% 6.20% 0.11% 0.00% NA
Indica Intermediate  786 87.50% 11.30% 0.76% 0.38% NA
Temperate Japonica  767 19.80% 72.10% 6.13% 1.96% NA
Tropical Japonica  504 11.70% 83.90% 3.57% 0.79% NA
Japonica Intermediate  241 7.90% 87.10% 3.73% 1.24% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 62.20% 32.20% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405375041 A -> DEL N N silent_mutation Average:67.046; most accessible tissue: Callus, score: 96.121 N N N N
vg0405375041 A -> G LOC_Os04g09990.1 upstream_gene_variant ; 2221.0bp to feature; MODIFIER silent_mutation Average:67.046; most accessible tissue: Callus, score: 96.121 N N N N
vg0405375041 A -> G LOC_Os04g09980.1 downstream_gene_variant ; 2507.0bp to feature; MODIFIER silent_mutation Average:67.046; most accessible tissue: Callus, score: 96.121 N N N N
vg0405375041 A -> G LOC_Os04g09980-LOC_Os04g09990 intergenic_region ; MODIFIER silent_mutation Average:67.046; most accessible tissue: Callus, score: 96.121 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405375041 1.63E-14 2.24E-29 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 5.89E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 1.26E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 7.26E-13 9.22E-27 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 8.81E-09 9.98E-14 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 7.78E-11 NA mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 6.93E-09 6.93E-09 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 2.83E-13 1.80E-24 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 5.57E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 2.75E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 1.10E-09 2.64E-36 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 9.47E-06 1.59E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 5.83E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 1.16E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 1.78E-06 1.78E-06 mr1726 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 3.54E-11 3.83E-23 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 2.68E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 4.15E-23 1.69E-36 mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 1.21E-06 NA mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 2.85E-14 2.24E-18 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 5.58E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 3.96E-08 3.96E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 7.41E-09 5.33E-40 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 5.77E-07 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405375041 NA 1.77E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251