\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405364448:

Variant ID: vg0405364448 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5364448
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, C: 0.37, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCTATTCTTTTATCTTAATTTTCTATATTTTTTTCCTTTGTCATCTCTTTTATAACATTTTCTATCCACATGTTTATAATTTTAAAAAGTAACCTAATTT[C/T]
CCCTAAACCATTTTTCTCTCTCATCTTTTTCCATAAACCCTGTTAGAGACAATAATGTATAGAAACTTAGCTATGAATGTACTCCCTCCGTCCTAAAATA

Reverse complement sequence

TATTTTAGGACGGAGGGAGTACATTCATAGCTAAGTTTCTATACATTATTGTCTCTAACAGGGTTTATGGAAAAAGATGAGAGAGAAAAATGGTTTAGGG[G/A]
AAATTAGGTTACTTTTTAAAATTATAAACATGTGGATAGAAAATGTTATAAAAGAGATGACAAAGGAAAAAAATATAGAAAATTAAGATAAAAGAATAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 31.10% 0.08% 0.00% NA
All Indica  2759 90.40% 9.50% 0.07% 0.00% NA
All Japonica  1512 22.20% 77.60% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 84.30% 15.70% 0.00% 0.00% NA
Indica III  913 93.80% 6.20% 0.00% 0.00% NA
Indica Intermediate  786 87.40% 12.30% 0.25% 0.00% NA
Temperate Japonica  767 19.80% 80.10% 0.13% 0.00% NA
Tropical Japonica  504 31.30% 68.50% 0.20% 0.00% NA
Japonica Intermediate  241 10.80% 89.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405364448 C -> T LOC_Os04g09980.1 upstream_gene_variant ; 2368.0bp to feature; MODIFIER silent_mutation Average:36.309; most accessible tissue: Callus, score: 46.519 N N N N
vg0405364448 C -> T LOC_Os04g09960.1 downstream_gene_variant ; 4709.0bp to feature; MODIFIER silent_mutation Average:36.309; most accessible tissue: Callus, score: 46.519 N N N N
vg0405364448 C -> T LOC_Os04g09960-LOC_Os04g09980 intergenic_region ; MODIFIER silent_mutation Average:36.309; most accessible tissue: Callus, score: 46.519 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405364448 8.12E-14 5.75E-28 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 NA 5.89E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 4.95E-06 4.35E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 1.82E-12 1.27E-25 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 9.53E-09 2.79E-12 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 NA 5.37E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 NA 1.09E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 8.79E-11 8.34E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 9.27E-09 9.27E-09 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 1.57E-13 1.13E-24 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 NA 5.57E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 1.93E-06 6.47E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 1.39E-10 2.72E-36 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 9.47E-06 1.59E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 NA 3.02E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 1.40E-06 7.00E-17 mr1726 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 3.27E-07 3.27E-07 mr1726 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 NA 7.23E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 NA 1.02E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 3.40E-14 5.83E-26 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 2.92E-06 3.11E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 3.40E-21 9.86E-34 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 1.21E-06 NA mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 3.20E-12 9.92E-15 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 8.13E-06 8.31E-06 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 1.97E-08 1.97E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 3.55E-12 3.93E-43 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405364448 4.76E-06 1.25E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251