Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405360131:

Variant ID: vg0405360131 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5360131
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATCACATAAAATCTAAATCAACTCCATGTTTCTACTAATCTATGTATTATTATATAATAAAAGTCCATTAAACTTCCTATAAACGCTCCTAAGCCGCCAC[A/G]
TGGCACTCCTACAAAAGCTATAAAGCCGTTATGTGGCACTCAAATAAATTATAGAAATTATGTAAATTATGTGAAAAAAAAATCTGACCATCGATTTTCA

Reverse complement sequence

TGAAAATCGATGGTCAGATTTTTTTTTCACATAATTTACATAATTTCTATAATTTATTTGAGTGCCACATAACGGCTTTATAGCTTTTGTAGGAGTGCCA[T/C]
GTGGCGGCTTAGGAGCGTTTATAGGAAGTTTAATGGACTTTTATTATATAATAATACATAGATTAGTAGAAACATGGAGTTGATTTAGATTTTATGTGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	34.80%	0.57%	0.04%	NA
All Indica	2759	90.40%	8.80%	0.83%	0.04%	NA
All Japonica	1512	10.40%	89.50%	0.07%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	91.60%	5.90%	2.52%	0.00%	NA
Indica II	465	86.20%	12.50%	1.29%	0.00%	NA
Indica III	913	93.60%	6.20%	0.11%	0.00%	NA
Indica Intermediate	786	88.00%	11.70%	0.13%	0.13%	NA
Temperate Japonica	767	8.50%	91.50%	0.00%	0.00%	NA
Tropical Japonica	504	13.70%	86.30%	0.00%	0.00%	NA
Japonica Intermediate	241	10.00%	89.60%	0.41%	0.00%	NA
VI/Aromatic	96	87.50%	11.50%	1.04%	0.00%	NA
Intermediate	90	57.80%	40.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405360131	A -> DEL	N	N	silent_mutation	Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0405360131	A -> G	LOC_Os04g09950.1	downstream_gene_variant ; 2340.0bp to feature; MODIFIER	silent_mutation	Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0405360131	A -> G	LOC_Os04g09960.1	downstream_gene_variant ; 392.0bp to feature; MODIFIER	silent_mutation	Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0405360131	A -> G	LOC_Os04g09960-LOC_Os04g09980	intergenic_region ; MODIFIER	silent_mutation	Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405360131	NA	1.63E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405360131	3.79E-06	6.18E-20	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	3.45E-06	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	7.67E-47	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	3.82E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	9.15E-07	mr1395	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	4.98E-06	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	9.63E-06	1.11E-16	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	6.88E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	6.20E-06	6.49E-32	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	8.27E-06	1.81E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	3.71E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	8.00E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	1.40E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	3.23E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	4.66E-52	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	2.49E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131	NA	2.59E-14	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251