\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405360131:

Variant ID: vg0405360131 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5360131
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATCACATAAAATCTAAATCAACTCCATGTTTCTACTAATCTATGTATTATTATATAATAAAAGTCCATTAAACTTCCTATAAACGCTCCTAAGCCGCCAC[A/G]
TGGCACTCCTACAAAAGCTATAAAGCCGTTATGTGGCACTCAAATAAATTATAGAAATTATGTAAATTATGTGAAAAAAAAATCTGACCATCGATTTTCA

Reverse complement sequence

TGAAAATCGATGGTCAGATTTTTTTTTCACATAATTTACATAATTTCTATAATTTATTTGAGTGCCACATAACGGCTTTATAGCTTTTGTAGGAGTGCCA[T/C]
GTGGCGGCTTAGGAGCGTTTATAGGAAGTTTAATGGACTTTTATTATATAATAATACATAGATTAGTAGAAACATGGAGTTGATTTAGATTTTATGTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 34.80% 0.57% 0.04% NA
All Indica  2759 90.40% 8.80% 0.83% 0.04% NA
All Japonica  1512 10.40% 89.50% 0.07% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 91.60% 5.90% 2.52% 0.00% NA
Indica II  465 86.20% 12.50% 1.29% 0.00% NA
Indica III  913 93.60% 6.20% 0.11% 0.00% NA
Indica Intermediate  786 88.00% 11.70% 0.13% 0.13% NA
Temperate Japonica  767 8.50% 91.50% 0.00% 0.00% NA
Tropical Japonica  504 13.70% 86.30% 0.00% 0.00% NA
Japonica Intermediate  241 10.00% 89.60% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 57.80% 40.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405360131 A -> DEL N N silent_mutation Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0405360131 A -> G LOC_Os04g09950.1 downstream_gene_variant ; 2340.0bp to feature; MODIFIER silent_mutation Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0405360131 A -> G LOC_Os04g09960.1 downstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0405360131 A -> G LOC_Os04g09960-LOC_Os04g09980 intergenic_region ; MODIFIER silent_mutation Average:35.913; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405360131 NA 1.63E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405360131 3.79E-06 6.18E-20 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 3.45E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 7.67E-47 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 3.82E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 9.15E-07 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 4.98E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 9.63E-06 1.11E-16 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 6.88E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 6.20E-06 6.49E-32 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 8.27E-06 1.81E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 3.71E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 8.00E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 1.40E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 3.23E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 4.66E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 2.49E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405360131 NA 2.59E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251