\
| Variant ID: vg0405360103 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5360103 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 81. )
TAGAATATCGCAAACCACCATGGCATTCATCACATAAAATCTAAATCAACTCCATGTTTCTACTAATCTATGTATTATTATATAATAAAAGTCCATTAAA[C/T]
TTCCTATAAACGCTCCTAAGCCGCCACATGGCACTCCTACAAAAGCTATAAAGCCGTTATGTGGCACTCAAATAAATTATAGAAATTATGTAAATTATGT
ACATAATTTACATAATTTCTATAATTTATTTGAGTGCCACATAACGGCTTTATAGCTTTTGTAGGAGTGCCATGTGGCGGCTTAGGAGCGTTTATAGGAA[G/A]
TTTAATGGACTTTTATTATATAATAATACATAGATTAGTAGAAACATGGAGTTGATTTAGATTTTATGTGATGAATGCCATGGTGGTTTGCGATATTCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 40.00% | 0.30% | 0.06% | NA |
| All Indica | 2759 | 81.80% | 17.70% | 0.43% | 0.07% | NA |
| All Japonica | 1512 | 10.40% | 89.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.37% | 0.37% | NA |
| Indica I | 595 | 93.10% | 5.50% | 1.34% | 0.00% | NA |
| Indica II | 465 | 87.50% | 12.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 69.40% | 30.20% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 84.40% | 15.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 8.20% | 91.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.90% | 86.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 89.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405360103 | C -> DEL | N | N | silent_mutation | Average:39.813; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0405360103 | C -> T | LOC_Os04g09950.1 | downstream_gene_variant ; 2312.0bp to feature; MODIFIER | silent_mutation | Average:39.813; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0405360103 | C -> T | LOC_Os04g09960.1 | downstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:39.813; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0405360103 | C -> T | LOC_Os04g09960-LOC_Os04g09980 | intergenic_region ; MODIFIER | silent_mutation | Average:39.813; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405360103 | NA | 7.24E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0405360103 | NA | 3.21E-10 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | 9.95E-07 | 1.19E-20 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 3.99E-06 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 2.06E-47 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 3.81E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 7.36E-07 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | 4.40E-06 | NA | mr1419 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 8.59E-07 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 9.33E-06 | mr1618 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | 3.39E-06 | 3.26E-17 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 8.94E-06 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | 1.72E-06 | 1.10E-32 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | 7.96E-06 | 1.30E-06 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 2.59E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 3.49E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 7.29E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 1.46E-16 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 9.80E-18 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 1.96E-52 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 1.36E-18 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405360103 | NA | 1.18E-29 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |