Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405358102:

Variant ID: vg0405358102 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5358102
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACAAAGCTCTCGAGGAGGCTGGAGCCGCCAACAGGCCAGAACATGATGTTGTCGACCACGTCACTATTGTCGAGAAGCACAAGAAGGCCTTCCCATCAC[A/T]
GCGGTCGAGACCTCTGTGACCAGTTGAATGGGAGAAGGCAAGAGCGTCAAAACCAGCATAACACCGGACACCGACAATTGTCCGATAATGGTCATGACAG

Reverse complement sequence

CTGTCATGACCATTATCGGACAATTGTCGGTGTCCGGTGTTATGCTGGTTTTGACGCTCTTGCCTTCTCCCATTCAACTGGTCACAGAGGTCTCGACCGC[T/A]
GTGATGGGAAGGCCTTCTTGTGCTTCTCGACAATAGTGACGTGGTCGACAACATCATGTTCTGGCCTGTTGGCGGCTCCAGCCTCCTCGAGAGCTTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	34.40%	0.06%	0.00%	NA
All Indica	2759	91.80%	8.20%	0.07%	0.00%	NA
All Japonica	1512	10.60%	89.40%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.00%	4.90%	0.17%	0.00%	NA
Indica II	465	88.60%	11.40%	0.00%	0.00%	NA
Indica III	913	93.90%	6.10%	0.00%	0.00%	NA
Indica Intermediate	786	88.80%	11.10%	0.13%	0.00%	NA
Temperate Japonica	767	8.60%	91.40%	0.00%	0.00%	NA
Tropical Japonica	504	13.90%	85.90%	0.20%	0.00%	NA
Japonica Intermediate	241	10.00%	90.00%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405358102	A -> T	LOC_Os04g09960.1	upstream_gene_variant ; 206.0bp to feature; MODIFIER	silent_mutation	Average:48.982; most accessible tissue: Zhenshan97 young leaf, score: 82.077	N	N	N	N
vg0405358102	A -> T	LOC_Os04g09950.1	downstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:48.982; most accessible tissue: Zhenshan97 young leaf, score: 82.077	N	N	N	N
vg0405358102	A -> T	LOC_Os04g09950-LOC_Os04g09960	intergenic_region ; MODIFIER	silent_mutation	Average:48.982; most accessible tissue: Zhenshan97 young leaf, score: 82.077	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405358102	NA	2.19E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405358102	NA	2.15E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	1.98E-07	2.86E-21	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	4.84E-06	1.99E-07	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	4.05E-06	8.78E-50	mr1136	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	2.32E-06	2.75E-17	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	9.63E-06	1.84E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	3.95E-07	1.15E-33	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	2.27E-06	3.42E-07	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	NA	1.26E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	NA	4.88E-17	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	NA	7.44E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	NA	1.32E-54	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405358102	NA	2.73E-32	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251