\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405316061:

Variant ID: vg0405316061 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 5316061
Reference Allele: AGCCAlternative Allele: GGCC,A
Primary Allele: AGCCSecondary Allele: GGCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTCCATTTATTTTATTGTGACTTGATTCGTCATCAAATATTCTTTAAGTATGACATAAATATTTTCATATTTGCACAAAAATTTTAAATAAAACGAAT[AGCC/GGCC,A]
AAACGTTGGTTGAAAAGTCAACGGTGTCATACATTAAATACGGAGGGAGTAGCATCGATCGTCGTTTTGTTTTCTTCTTCCAATAGCGCAGTAGAATACT

Reverse complement sequence

AGTATTCTACTGCGCTATTGGAAGAAGAAAACAAAACGACGATCGATGCTACTCCCTCCGTATTTAATGTATGACACCGTTGACTTTTCAACCAACGTTT[GGCT/GGCC,T]
ATTCGTTTTATTTAAAATTTTTGTGCAAATATGAAAATATTTATGTCATACTTAAAGAATATTTGATGACGAATCAAGTCACAATAAAATAAATGGAGGT

Allele Frequencies:

Populations Population SizeFrequency of AGCC(primary allele) Frequency of GGCC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 47.80% 0.23% 0.00% A: 0.02%
All Indica  2759 45.80% 53.90% 0.22% 0.00% A: 0.04%
All Japonica  1512 67.20% 32.80% 0.00% 0.00% NA
Aus  269 37.90% 61.70% 0.37% 0.00% NA
Indica I  595 12.80% 86.90% 0.34% 0.00% NA
Indica II  465 43.70% 56.10% 0.00% 0.00% A: 0.22%
Indica III  913 65.60% 34.20% 0.22% 0.00% NA
Indica Intermediate  786 49.10% 50.60% 0.25% 0.00% NA
Temperate Japonica  767 56.80% 43.20% 0.00% 0.00% NA
Tropical Japonica  504 76.20% 23.80% 0.00% 0.00% NA
Japonica Intermediate  241 81.30% 18.70% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 64.60% 1.04% 0.00% NA
Intermediate  90 44.40% 52.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405316061 AGCC -> GGCC LOC_Os04g09900.1 upstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> GGCC LOC_Os04g09900.3 upstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> GGCC LOC_Os04g09900.2 upstream_gene_variant ; 2286.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> GGCC LOC_Os04g09880.1 downstream_gene_variant ; 3255.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> GGCC LOC_Os04g09880-LOC_Os04g09900 intergenic_region ; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> A LOC_Os04g09900.1 upstream_gene_variant ; 1998.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> A LOC_Os04g09900.3 upstream_gene_variant ; 2008.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> A LOC_Os04g09900.2 upstream_gene_variant ; 2285.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> A LOC_Os04g09880.1 downstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N
vg0405316061 AGCC -> A LOC_Os04g09880-LOC_Os04g09900 intergenic_region ; MODIFIER silent_mutation Average:53.746; most accessible tissue: Callus, score: 85.211 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405316061 3.37E-08 2.50E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 NA 1.13E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 1.17E-06 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 NA 2.04E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 6.11E-06 NA mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 2.08E-07 1.88E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 NA 6.38E-09 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 5.97E-06 5.97E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 3.02E-07 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 NA 2.81E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 NA 4.86E-06 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 2.49E-08 2.22E-17 mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 3.21E-06 2.07E-10 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 3.04E-06 3.06E-06 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 1.84E-06 1.84E-06 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 2.59E-10 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405316061 8.19E-07 2.70E-11 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251