\
| Variant ID: vg0405316061 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 5316061 |
| Reference Allele: AGCC | Alternative Allele: GGCC,A |
| Primary Allele: AGCC | Secondary Allele: GGCC |
Inferred Ancestral Allele: Not determined.
ACCTCCATTTATTTTATTGTGACTTGATTCGTCATCAAATATTCTTTAAGTATGACATAAATATTTTCATATTTGCACAAAAATTTTAAATAAAACGAAT[AGCC/GGCC,A]
AAACGTTGGTTGAAAAGTCAACGGTGTCATACATTAAATACGGAGGGAGTAGCATCGATCGTCGTTTTGTTTTCTTCTTCCAATAGCGCAGTAGAATACT
AGTATTCTACTGCGCTATTGGAAGAAGAAAACAAAACGACGATCGATGCTACTCCCTCCGTATTTAATGTATGACACCGTTGACTTTTCAACCAACGTTT[GGCT/GGCC,T]
ATTCGTTTTATTTAAAATTTTTGTGCAAATATGAAAATATTTATGTCATACTTAAAGAATATTTGATGACGAATCAAGTCACAATAAAATAAATGGAGGT
| Populations | Population Size | Frequency of AGCC(primary allele) | Frequency of GGCC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 47.80% | 0.23% | 0.00% | A: 0.02% |
| All Indica | 2759 | 45.80% | 53.90% | 0.22% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 67.20% | 32.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.90% | 61.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 12.80% | 86.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 43.70% | 56.10% | 0.00% | 0.00% | A: 0.22% |
| Indica III | 913 | 65.60% | 34.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 49.10% | 50.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 56.80% | 43.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 34.40% | 64.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 52.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405316061 | AGCC -> GGCC | LOC_Os04g09900.1 | upstream_gene_variant ; 1999.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> GGCC | LOC_Os04g09900.3 | upstream_gene_variant ; 2009.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> GGCC | LOC_Os04g09900.2 | upstream_gene_variant ; 2286.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> GGCC | LOC_Os04g09880.1 | downstream_gene_variant ; 3255.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> GGCC | LOC_Os04g09880-LOC_Os04g09900 | intergenic_region ; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> A | LOC_Os04g09900.1 | upstream_gene_variant ; 1998.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> A | LOC_Os04g09900.3 | upstream_gene_variant ; 2008.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> A | LOC_Os04g09900.2 | upstream_gene_variant ; 2285.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> A | LOC_Os04g09880.1 | downstream_gene_variant ; 3256.0bp to feature; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| vg0405316061 | AGCC -> A | LOC_Os04g09880-LOC_Os04g09900 | intergenic_region ; MODIFIER | silent_mutation | Average:53.746; most accessible tissue: Callus, score: 85.211 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405316061 | 3.37E-08 | 2.50E-16 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | NA | 1.13E-08 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 1.17E-06 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | NA | 2.04E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 6.11E-06 | NA | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 2.08E-07 | 1.88E-14 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | NA | 6.38E-09 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 5.97E-06 | 5.97E-06 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 3.02E-07 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | NA | 2.81E-08 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | NA | 4.86E-06 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 2.49E-08 | 2.22E-17 | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 3.21E-06 | 2.07E-10 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 3.04E-06 | 3.06E-06 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 1.84E-06 | 1.84E-06 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 2.59E-10 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405316061 | 8.19E-07 | 2.70E-11 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |