\
| Variant ID: vg0405309804 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5309804 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.09, C: 0.01, others allele: 0.00, population size: 85. )
AAGAAATACTAAGAGTCGACTCTAAACCGTTGTCGTACATAACAACTATATTTCTCTTTCCTCGTTTCTCTTTCTTCCATGTCATCAAACTTACTTGCAT[G/A,C]
GTAACATAGAGAGACCACTAATAAAAAAAACCGTTGTACATGCCCTAATTTGGATCTTGTAGTTTCAAAATCATATTGTTCCACTTGCTCTCCTGCAGAT
ATCTGCAGGAGAGCAAGTGGAACAATATGATTTTGAAACTACAAGATCCAAATTAGGGCATGTACAACGGTTTTTTTTATTAGTGGTCTCTCTATGTTAC[C/T,G]
ATGCAAGTAAGTTTGATGACATGGAAGAAAGAGAAACGAGGAAAGAGAAATATAGTTGTTATGTACGACAACGGTTTAGAGTCGACTCTTAGTATTTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 40.30% | 0.25% | 8.36% | C: 0.06% |
| All Indica | 2759 | 48.00% | 51.40% | 0.14% | 0.43% | C: 0.04% |
| All Japonica | 1512 | 68.80% | 6.40% | 0.40% | 24.34% | NA |
| Aus | 269 | 2.60% | 96.70% | 0.00% | 0.00% | C: 0.74% |
| Indica I | 595 | 59.50% | 40.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 36.10% | 63.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 51.00% | 48.10% | 0.11% | 0.66% | C: 0.11% |
| Indica Intermediate | 786 | 42.70% | 56.50% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 66.00% | 0.50% | 0.78% | 32.72% | NA |
| Tropical Japonica | 504 | 65.90% | 15.50% | 0.00% | 18.65% | NA |
| Japonica Intermediate | 241 | 84.20% | 6.20% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 3.10% | 90.60% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 42.20% | 45.60% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405309804 | G -> C | LOC_Os04g09880.1 | upstream_gene_variant ; 1630.0bp to feature; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0405309804 | G -> C | LOC_Os04g09870.1 | downstream_gene_variant ; 728.0bp to feature; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0405309804 | G -> C | LOC_Os04g09870-LOC_Os04g09880 | intergenic_region ; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0405309804 | G -> DEL | N | N | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0405309804 | G -> A | LOC_Os04g09880.1 | upstream_gene_variant ; 1630.0bp to feature; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0405309804 | G -> A | LOC_Os04g09870.1 | downstream_gene_variant ; 728.0bp to feature; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0405309804 | G -> A | LOC_Os04g09870-LOC_Os04g09880 | intergenic_region ; MODIFIER | silent_mutation | Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405309804 | 1.56E-08 | 1.03E-14 | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 1.26E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | 2.98E-06 | 7.46E-16 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 1.41E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 9.76E-08 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | 7.71E-06 | 7.70E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | 1.14E-07 | 8.23E-13 | mr1626 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 2.05E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | 8.25E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 1.08E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | 1.39E-09 | NA | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 5.11E-08 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 3.92E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405309804 | NA | 4.37E-09 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |