\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405309804:

Variant ID: vg0405309804 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5309804
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.09, C: 0.01, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAAATACTAAGAGTCGACTCTAAACCGTTGTCGTACATAACAACTATATTTCTCTTTCCTCGTTTCTCTTTCTTCCATGTCATCAAACTTACTTGCAT[G/A,C]
GTAACATAGAGAGACCACTAATAAAAAAAACCGTTGTACATGCCCTAATTTGGATCTTGTAGTTTCAAAATCATATTGTTCCACTTGCTCTCCTGCAGAT

Reverse complement sequence

ATCTGCAGGAGAGCAAGTGGAACAATATGATTTTGAAACTACAAGATCCAAATTAGGGCATGTACAACGGTTTTTTTTATTAGTGGTCTCTCTATGTTAC[C/T,G]
ATGCAAGTAAGTTTGATGACATGGAAGAAAGAGAAACGAGGAAAGAGAAATATAGTTGTTATGTACGACAACGGTTTAGAGTCGACTCTTAGTATTTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 40.30% 0.25% 8.36% C: 0.06%
All Indica  2759 48.00% 51.40% 0.14% 0.43% C: 0.04%
All Japonica  1512 68.80% 6.40% 0.40% 24.34% NA
Aus  269 2.60% 96.70% 0.00% 0.00% C: 0.74%
Indica I  595 59.50% 40.30% 0.17% 0.00% NA
Indica II  465 36.10% 63.40% 0.00% 0.43% NA
Indica III  913 51.00% 48.10% 0.11% 0.66% C: 0.11%
Indica Intermediate  786 42.70% 56.50% 0.25% 0.51% NA
Temperate Japonica  767 66.00% 0.50% 0.78% 32.72% NA
Tropical Japonica  504 65.90% 15.50% 0.00% 18.65% NA
Japonica Intermediate  241 84.20% 6.20% 0.00% 9.54% NA
VI/Aromatic  96 3.10% 90.60% 0.00% 6.25% NA
Intermediate  90 42.20% 45.60% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405309804 G -> C LOC_Os04g09880.1 upstream_gene_variant ; 1630.0bp to feature; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0405309804 G -> C LOC_Os04g09870.1 downstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0405309804 G -> C LOC_Os04g09870-LOC_Os04g09880 intergenic_region ; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0405309804 G -> DEL N N silent_mutation Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0405309804 G -> A LOC_Os04g09880.1 upstream_gene_variant ; 1630.0bp to feature; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0405309804 G -> A LOC_Os04g09870.1 downstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0405309804 G -> A LOC_Os04g09870-LOC_Os04g09880 intergenic_region ; MODIFIER silent_mutation Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405309804 1.56E-08 1.03E-14 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 1.26E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 2.98E-06 7.46E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 1.41E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 9.76E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 7.71E-06 7.70E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 1.14E-07 8.23E-13 mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 2.05E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 8.25E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 1.08E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 1.39E-09 NA mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 5.11E-08 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 3.92E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804 NA 4.37E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251