Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405309804:

Variant ID: vg0405309804 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5309804
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.09, C: 0.01, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAAATACTAAGAGTCGACTCTAAACCGTTGTCGTACATAACAACTATATTTCTCTTTCCTCGTTTCTCTTTCTTCCATGTCATCAAACTTACTTGCAT[G/A,C]
GTAACATAGAGAGACCACTAATAAAAAAAACCGTTGTACATGCCCTAATTTGGATCTTGTAGTTTCAAAATCATATTGTTCCACTTGCTCTCCTGCAGAT

Reverse complement sequence

ATCTGCAGGAGAGCAAGTGGAACAATATGATTTTGAAACTACAAGATCCAAATTAGGGCATGTACAACGGTTTTTTTTATTAGTGGTCTCTCTATGTTAC[C/T,G]
ATGCAAGTAAGTTTGATGACATGGAAGAAAGAGAAACGAGGAAAGAGAAATATAGTTGTTATGTACGACAACGGTTTAGAGTCGACTCTTAGTATTTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	40.30%	0.25%	8.36%	C: 0.06%
All Indica	2759	48.00%	51.40%	0.14%	0.43%	C: 0.04%
All Japonica	1512	68.80%	6.40%	0.40%	24.34%	NA
Aus	269	2.60%	96.70%	0.00%	0.00%	C: 0.74%
Indica I	595	59.50%	40.30%	0.17%	0.00%	NA
Indica II	465	36.10%	63.40%	0.00%	0.43%	NA
Indica III	913	51.00%	48.10%	0.11%	0.66%	C: 0.11%
Indica Intermediate	786	42.70%	56.50%	0.25%	0.51%	NA
Temperate Japonica	767	66.00%	0.50%	0.78%	32.72%	NA
Tropical Japonica	504	65.90%	15.50%	0.00%	18.65%	NA
Japonica Intermediate	241	84.20%	6.20%	0.00%	9.54%	NA
VI/Aromatic	96	3.10%	90.60%	0.00%	6.25%	NA
Intermediate	90	42.20%	45.60%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405309804	G -> C	LOC_Os04g09880.1	upstream_gene_variant ; 1630.0bp to feature; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0405309804	G -> C	LOC_Os04g09870.1	downstream_gene_variant ; 728.0bp to feature; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0405309804	G -> C	LOC_Os04g09870-LOC_Os04g09880	intergenic_region ; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0405309804	G -> DEL	N	N	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0405309804	G -> A	LOC_Os04g09880.1	upstream_gene_variant ; 1630.0bp to feature; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0405309804	G -> A	LOC_Os04g09870.1	downstream_gene_variant ; 728.0bp to feature; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0405309804	G -> A	LOC_Os04g09870-LOC_Os04g09880	intergenic_region ; MODIFIER	silent_mutation	Average:57.687; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405309804	1.56E-08	1.03E-14	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	1.26E-07	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	2.98E-06	7.46E-16	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	1.41E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	9.76E-08	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	7.71E-06	7.70E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	1.14E-07	8.23E-13	mr1626	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	2.05E-06	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	8.25E-06	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	1.08E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	1.39E-09	NA	mr1062_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	5.11E-08	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	3.92E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405309804	NA	4.37E-09	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251