\
| Variant ID: vg0405302070 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5302070 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAACCACTTGACCCATTTTGGGTAGGTCTGAGAAATTGGGTGCATGCTAAAGCATCGAACAATATTGGACTTGATTGCAGATCACAAAAAAGAAAAAAAA[C/A]
GAAAAAAAGAGAGAAGTGATGAAGGGATATTGAGATCAAAGAAAATACTAACGCTTTGTTTCAACATGTTCCTGATATGTGTTTTAAGATGGAGAAATAT
ATATTTCTCCATCTTAAAACACATATCAGGAACATGTTGAAACAAAGCGTTAGTATTTTCTTTGATCTCAATATCCCTTCATCACTTCTCTCTTTTTTTC[G/T]
TTTTTTTTCTTTTTTGTGATCTGCAATCAAGTCCAATATTGTTCGATGCTTTAGCATGCACCCAATTTCTCAGACCTACCCAAAATGGGTCAAGTGGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 38.10% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 44.40% | 55.30% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 39.00% | 61.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.90% | 56.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 38.10% | 61.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 42.50% | 57.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 50.80% | 48.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 38.50% | 59.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405302070 | C -> A | LOC_Os04g09860-LOC_Os04g09870 | intergenic_region ; MODIFIER | silent_mutation | Average:39.693; most accessible tissue: Callus, score: 76.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405302070 | 2.85E-12 | 5.62E-27 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 1.43E-06 | 2.58E-08 | mr1035 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 7.56E-08 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 9.22E-07 | 6.67E-19 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 2.00E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 2.50E-09 | 2.44E-21 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 4.39E-06 | 4.45E-07 | mr1626 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 1.50E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 1.06E-07 | 7.55E-31 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 6.14E-06 | 5.36E-07 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 5.07E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 1.00E-13 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 1.02E-10 | 9.99E-23 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 1.08E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 3.14E-08 | 1.69E-22 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 5.98E-06 | 2.08E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 9.37E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | 4.43E-12 | 1.30E-40 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405302070 | NA | 3.86E-09 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |