Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405302070:

Variant ID: vg0405302070 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5302070
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACCACTTGACCCATTTTGGGTAGGTCTGAGAAATTGGGTGCATGCTAAAGCATCGAACAATATTGGACTTGATTGCAGATCACAAAAAAGAAAAAAAA[C/A]
GAAAAAAAGAGAGAAGTGATGAAGGGATATTGAGATCAAAGAAAATACTAACGCTTTGTTTCAACATGTTCCTGATATGTGTTTTAAGATGGAGAAATAT

Reverse complement sequence

ATATTTCTCCATCTTAAAACACATATCAGGAACATGTTGAAACAAAGCGTTAGTATTTTCTTTGATCTCAATATCCCTTCATCACTTCTCTCTTTTTTTC[G/T]
TTTTTTTTCTTTTTTGTGATCTGCAATCAAGTCCAATATTGTTCGATGCTTTAGCATGCACCCAATTTCTCAGACCTACCCAAAATGGGTCAAGTGGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 38.10% 0.21% 0.00% NA
All Indica  2759 44.40% 55.30% 0.25% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 39.00% 61.00% 0.00% 0.00% NA
Indica I  595 43.90% 56.00% 0.17% 0.00% NA
Indica II  465 38.10% 61.70% 0.22% 0.00% NA
Indica III  913 42.50% 57.40% 0.11% 0.00% NA
Indica Intermediate  786 50.80% 48.70% 0.51% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 59.40% 2.08% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405302070 C -> A LOC_Os04g09860-LOC_Os04g09870 intergenic_region ; MODIFIER silent_mutation Average:39.693; most accessible tissue: Callus, score: 76.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405302070 2.85E-12 5.62E-27 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 1.43E-06 2.58E-08 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 7.56E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 9.22E-07 6.67E-19 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 2.00E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 2.50E-09 2.44E-21 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 4.39E-06 4.45E-07 mr1626 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 1.50E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 1.06E-07 7.55E-31 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 6.14E-06 5.36E-07 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 5.07E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 1.00E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 1.02E-10 9.99E-23 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 1.08E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 3.14E-08 1.69E-22 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 5.98E-06 2.08E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 9.37E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 4.43E-12 1.30E-40 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405302070 NA 3.86E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251