Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405298921:

Variant ID: vg0405298921 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5298921
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

ATAATTTAGGGCATACATCTCCACCGTATGGAAGCGCCAGGGCTGTGTGGGGTAAAGCAACACCATCCTGCATACATCAAGGAGGACAATATATTGGTAC[G/A]
TAAGCAGTATCTAGAAAGCTAAAGAAAAGCTATTCATATTACGACTTAAGAATACAACCCTCATTTCTCAATGGCTAGTGAAAGACCAAAGAAAATGCTA

Reverse complement sequence

TAGCATTTTCTTTGGTCTTTCACTAGCCATTGAGAAATGAGGGTTGTATTCTTAAGTCGTAATATGAATAGCTTTTCTTTAGCTTTCTAGATACTGCTTA[C/T]
GTACCAATATATTGTCCTCCTTGATGTATGCAGGATGGTGTTGCTTTACCCCACACAGCCCTGGCGCTTCCATACGGTGGAGATGTATGCCCTAAATTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	46.00%	0.13%	0.13%	NA
All Indica	2759	44.90%	54.70%	0.22%	0.14%	NA
All Japonica	1512	73.70%	26.30%	0.00%	0.00%	NA
Aus	269	39.00%	61.00%	0.00%	0.00%	NA
Indica I	595	43.70%	56.10%	0.00%	0.17%	NA
Indica II	465	41.90%	57.80%	0.22%	0.00%	NA
Indica III	913	42.10%	57.90%	0.00%	0.00%	NA
Indica Intermediate	786	50.90%	48.10%	0.64%	0.38%	NA
Temperate Japonica	767	65.20%	34.80%	0.00%	0.00%	NA
Tropical Japonica	504	80.60%	19.40%	0.00%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	33.30%	64.60%	0.00%	2.08%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405298921	G -> DEL	N	N	silent_mutation	Average:48.835; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N
vg0405298921	G -> A	LOC_Os04g09860-LOC_Os04g09870	intergenic_region ; MODIFIER	silent_mutation	Average:48.835; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405298921	1.06E-07	6.08E-17	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	NA	4.81E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	1.12E-06	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	NA	3.70E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	3.42E-07	2.84E-07	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	1.53E-06	2.42E-14	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	NA	4.32E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	6.16E-07	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	2.49E-06	1.30E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	2.17E-06	2.19E-06	mr1525_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	1.52E-07	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405298921	NA	1.27E-07	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251