Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405271834:

Variant ID: vg0405271834 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5271834
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GGGAGTAAAATAAAAATTGCGGCCGCTCCAGAATAGATATGGACATGTGGCTAGATCCATTTGAAAGTAGACCTGATAAGCTTTCCATGAAGTACTTGCA[T/C]
GCACAAATCGGAGTTCGCATGAAGTCCTGGCGGCCGTCAGAAGTTAGCGTTGTCCTGCAGTCCGAATCCACCCCGCGCGAATCCTCTCCCCTTTGGATCC

Reverse complement sequence

GGATCCAAAGGGGAGAGGATTCGCGCGGGGTGGATTCGGACTGCAGGACAACGCTAACTTCTGACGGCCGCCAGGACTTCATGCGAACTCCGATTTGTGC[A/G]
TGCAAGTACTTCATGGAAAGCTTATCAGGTCTACTTTCAAATGGATCTAGCCACATGTCCATATCTATTCTGGAGCGGCCGCAATTTTTATTTTACTCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.10%	36.80%	0.04%	0.00%	NA
All Indica	2759	71.50%	28.50%	0.04%	0.00%	NA
All Japonica	1512	38.80%	61.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	40.30%	59.70%	0.00%	0.00%	NA
Indica II	465	91.80%	8.20%	0.00%	0.00%	NA
Indica III	913	79.50%	20.40%	0.11%	0.00%	NA
Indica Intermediate	786	73.70%	26.30%	0.00%	0.00%	NA
Temperate Japonica	767	44.50%	55.40%	0.13%	0.00%	NA
Tropical Japonica	504	38.70%	61.30%	0.00%	0.00%	NA
Japonica Intermediate	241	21.20%	78.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405271834	T -> C	LOC_Os04g09820.1	downstream_gene_variant ; 2457.0bp to feature; MODIFIER	silent_mutation	Average:45.979; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0405271834	T -> C	LOC_Os04g09810-LOC_Os04g09820	intergenic_region ; MODIFIER	silent_mutation	Average:45.979; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405271834	1.38E-07	5.40E-16	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	NA	3.71E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	NA	5.79E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	1.50E-06	1.50E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	1.01E-06	1.42E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	NA	1.12E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	4.05E-07	8.28E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	4.31E-06	1.29E-09	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	3.13E-06	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	1.41E-06	9.79E-10	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	1.91E-07	1.91E-07	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	4.01E-06	NA	mr1631_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	4.05E-08	4.56E-13	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271834	NA	2.85E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251