Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405268315:

Variant ID: vg0405268315 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5268315
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATACGACCTGGCGCCCGTTTTAGTGTAGACTGGTCCTAGACTCCGAATTACACCCGACGTCGACTTGGTTTGGGCCTCCACCTTGACTTGGACATCCT[T/C]
GATGATCCTCCATGGCTCTAAGTCCTTCTCCAAGTGTCTCCTTGTTCCCTCCATTGTTTCTAATCATAATATAATCATTATGTAGCAATCTAGTCTCGAA

Reverse complement sequence

TTCGAGACTAGATTGCTACATAATGATTATATTATGATTAGAAACAATGGAGGGAACAAGGAGACACTTGGAGAAGGACTTAGAGCCATGGAGGATCATC[A/G]
AGGATGTCCAAGTCAAGGTGGAGGCCCAAACCAAGTCGACGTCGGGTGTAATTCGGAGTCTAGGACCAGTCTACACTAAAACGGGCGCCAGGTCGTATAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.80%	41.70%	1.02%	0.49%	NA
All Indica	2759	50.30%	47.60%	1.30%	0.76%	NA
All Japonica	1512	62.40%	37.40%	0.20%	0.07%	NA
Aus	269	90.30%	8.60%	1.12%	0.00%	NA
Indica I	595	61.20%	37.80%	0.67%	0.34%	NA
Indica II	465	62.80%	35.50%	1.29%	0.43%	NA
Indica III	913	36.30%	61.70%	0.99%	1.10%	NA
Indica Intermediate	786	51.00%	45.90%	2.16%	0.89%	NA
Temperate Japonica	767	56.20%	43.80%	0.00%	0.00%	NA
Tropical Japonica	504	62.30%	37.10%	0.40%	0.20%	NA
Japonica Intermediate	241	82.20%	17.40%	0.41%	0.00%	NA
VI/Aromatic	96	62.50%	33.30%	3.12%	1.04%	NA
Intermediate	90	57.80%	38.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405268315	T -> C	LOC_Os04g09810.1	upstream_gene_variant ; 1563.0bp to feature; MODIFIER	silent_mutation	Average:28.885; most accessible tissue: Callus, score: 63.858	N	N	N	N
vg0405268315	T -> C	LOC_Os04g09810-LOC_Os04g09820	intergenic_region ; MODIFIER	silent_mutation	Average:28.885; most accessible tissue: Callus, score: 63.858	N	N	N	N
vg0405268315	T -> DEL	N	N	silent_mutation	Average:28.885; most accessible tissue: Callus, score: 63.858	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405268315	NA	9.27E-07	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405268315	NA	1.08E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405268315	4.03E-06	4.03E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405268315	NA	9.62E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405268315	6.78E-06	4.19E-09	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405268315	4.46E-06	3.67E-08	mr1062_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405268315	1.36E-06	1.36E-06	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405268315	3.02E-08	1.64E-13	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251