\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405251476:

Variant ID: vg0405251476 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5251476
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.43, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTGACATATCCTAATACTACGAATCTGGACATACATATGTCCAGATTCATCGTACTAGAATATGTCACATCCGATCGTAGATTTATTTTTTATGGGAC[A/G]
GAGGGGGTATAAGGTGGTGTTTGGATGGGAGGGACTTATTTTAGTTCCTCTCAGTAAGTCCCTCACATCCCAAACAGCCCCTAAGACCCTGTTTAGATAG

Reverse complement sequence

CTATCTAAACAGGGTCTTAGGGGCTGTTTGGGATGTGAGGGACTTACTGAGAGGAACTAAAATAAGTCCCTCCCATCCAAACACCACCTTATACCCCCTC[T/C]
GTCCCATAAAAAATAAATCTACGATCGGATGTGACATATTCTAGTACGATGAATCTGGACATATGTATGTCCAGATTCGTAGTATTAGGATATGTCACAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 26.40% 0.08% 0.00% NA
All Indica  2759 69.40% 30.50% 0.07% 0.00% NA
All Japonica  1512 75.50% 24.50% 0.07% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 44.00% 56.00% 0.00% 0.00% NA
Indica II  465 81.10% 18.90% 0.00% 0.00% NA
Indica III  913 77.90% 21.90% 0.22% 0.00% NA
Indica Intermediate  786 72.00% 28.00% 0.00% 0.00% NA
Temperate Japonica  767 64.40% 35.50% 0.13% 0.00% NA
Tropical Japonica  504 85.10% 14.90% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405251476 A -> G LOC_Os04g09780.1 upstream_gene_variant ; 3615.0bp to feature; MODIFIER silent_mutation Average:51.259; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0405251476 A -> G LOC_Os04g09790.1 upstream_gene_variant ; 767.0bp to feature; MODIFIER silent_mutation Average:51.259; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0405251476 A -> G LOC_Os04g09800.1 downstream_gene_variant ; 3265.0bp to feature; MODIFIER silent_mutation Average:51.259; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0405251476 A -> G LOC_Os04g09780-LOC_Os04g09790 intergenic_region ; MODIFIER silent_mutation Average:51.259; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405251476 NA 2.31E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 9.14E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 6.03E-06 mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 7.00E-07 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 9.00E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 9.61E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 2.53E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 5.40E-07 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 1.26E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 1.67E-06 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 3.45E-07 1.58E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 9.73E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 6.65E-06 mr1712_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 4.31E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 1.91E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405251476 NA 2.05E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251