\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405249563:

Variant ID: vg0405249563 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5249563
Reference Allele: CAlternative Allele: G,A
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCCTGTCGACCAATAGCAAGCATGCCGTCTTTGACCAGACAAGATGCAGGTCTCGTCAAGAGTCATTTTATCTCTGGCAGTTTGCTCATCATTTTTTA[C/G,A]
TTGGCTGTGTTTAGATCTAAAGTTTGGATCTAAACTTCAGTCCTTTTTCATCACATCAACCTGTCATACATATAATTTTTTTAGTCACATTATATCCAAT

Reverse complement sequence

ATTGGATATAATGTGACTAAAAAAATTATATGTATGACAGGTTGATGTGATGAAAAAGGACTGAAGTTTAGATCCAAACTTTAGATCTAAACACAGCCAA[G/C,T]
TAAAAAATGATGAGCAAACTGCCAGAGATAAAATGACTCTTGACGAGACCTGCATCTTGTCTGGTCAAAGACGGCATGCTTGCTATTGGTCGACAGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 23.40% 1.29% 12.38% A: 0.02%
All Indica  2759 58.30% 18.70% 2.03% 20.91% NA
All Japonica  1512 78.60% 21.20% 0.20% 0.00% A: 0.07%
Aus  269 10.40% 89.20% 0.00% 0.37% NA
Indica I  595 45.50% 1.00% 1.01% 52.44% NA
Indica II  465 41.10% 51.40% 4.09% 3.44% NA
Indica III  913 75.50% 11.50% 1.86% 11.17% NA
Indica Intermediate  786 58.30% 21.20% 1.78% 18.70% NA
Temperate Japonica  767 65.40% 34.20% 0.39% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.10% 0.00% 0.00% A: 0.41%
VI/Aromatic  96 90.60% 8.30% 1.04% 0.00% NA
Intermediate  90 67.80% 23.30% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405249563 C -> A LOC_Os04g09780.1 upstream_gene_variant ; 1702.0bp to feature; MODIFIER silent_mutation Average:73.593; most accessible tissue: Callus, score: 98.657 N N N N
vg0405249563 C -> A LOC_Os04g09790.1 upstream_gene_variant ; 2680.0bp to feature; MODIFIER silent_mutation Average:73.593; most accessible tissue: Callus, score: 98.657 N N N N
vg0405249563 C -> A LOC_Os04g09780-LOC_Os04g09790 intergenic_region ; MODIFIER silent_mutation Average:73.593; most accessible tissue: Callus, score: 98.657 N N N N
vg0405249563 C -> DEL N N silent_mutation Average:73.593; most accessible tissue: Callus, score: 98.657 N N N N
vg0405249563 C -> G LOC_Os04g09780.1 upstream_gene_variant ; 1702.0bp to feature; MODIFIER silent_mutation Average:73.593; most accessible tissue: Callus, score: 98.657 N N N N
vg0405249563 C -> G LOC_Os04g09790.1 upstream_gene_variant ; 2680.0bp to feature; MODIFIER silent_mutation Average:73.593; most accessible tissue: Callus, score: 98.657 N N N N
vg0405249563 C -> G LOC_Os04g09780-LOC_Os04g09790 intergenic_region ; MODIFIER silent_mutation Average:73.593; most accessible tissue: Callus, score: 98.657 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0405249563 C A 0.49 0.01 0.0 -0.11 -0.02 -0.03
vg0405249563 C G 0.14 0.02 0.01 -0.04 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405249563 1.77E-10 9.99E-16 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 2.85E-09 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 1.45E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 2.02E-09 2.16E-18 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 4.38E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 8.41E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 1.97E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 1.35E-08 1.88E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 1.90E-08 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 6.79E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 5.99E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 1.11E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 1.74E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 6.53E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 6.56E-09 1.42E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 1.42E-11 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 2.20E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 2.03E-06 2.04E-06 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 6.92E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 7.27E-07 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 8.12E-08 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 1.12E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405249563 NA 5.31E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251