\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405244442:

Variant ID: vg0405244442 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5244442
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGAGGAAGATGGATGGTACTCCCTTCATTCTAAAATAAACTGAAGGATATGATACATGTCCAAATTTATATAGGATGCATTATATCCTATACGAGAT[T/C]
ACATGTCTAGATTTATAGTGGTAGAAATATCTAAATTCATAGTATTAAAATACATCACATACTTACTATATAAGGTTAGTTTATTTTGGAAATTAGGGAG

Reverse complement sequence

CTCCCTAATTTCCAAAATAAACTAACCTTATATAGTAAGTATGTGATGTATTTTAATACTATGAATTTAGATATTTCTACCACTATAAATCTAGACATGT[A/G]
ATCTCGTATAGGATATAATGCATCCTATATAAATTTGGACATGTATCATATCCTTCAGTTTATTTTAGAATGAAGGGAGTACCATCCATCTTCCTCATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.90% 25.00% 2.16% 2.94% NA
All Indica  2759 74.40% 24.50% 1.09% 0.04% NA
All Japonica  1512 71.40% 15.00% 4.50% 9.06% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 34.60% 61.10% 4.30% 0.00% NA
Indica III  913 81.90% 17.60% 0.44% 0.00% NA
Indica Intermediate  786 71.00% 28.10% 0.76% 0.13% NA
Temperate Japonica  767 56.10% 18.80% 8.47% 16.69% NA
Tropical Japonica  504 87.90% 10.50% 0.60% 0.99% NA
Japonica Intermediate  241 85.90% 12.40% 0.00% 1.66% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 68.90% 26.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405244442 T -> C LOC_Os04g09770.1 upstream_gene_variant ; 1122.0bp to feature; MODIFIER silent_mutation Average:64.822; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0405244442 T -> C LOC_Os04g09780.1 downstream_gene_variant ; 2404.0bp to feature; MODIFIER silent_mutation Average:64.822; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0405244442 T -> C LOC_Os04g09770-LOC_Os04g09780 intergenic_region ; MODIFIER silent_mutation Average:64.822; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0405244442 T -> DEL N N silent_mutation Average:64.822; most accessible tissue: Minghui63 root, score: 90.598 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405244442 1.85E-07 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 2.76E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 3.29E-07 6.02E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 5.58E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 2.39E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 2.16E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 1.00E-06 NA mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 1.31E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 4.60E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 1.16E-06 NA mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 5.48E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 1.48E-06 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 2.72E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 NA 2.91E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 1.99E-07 1.99E-07 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 1.91E-08 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244442 7.25E-07 5.24E-11 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251