\
| Variant ID: vg0405244056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5244056 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATGAAAAAACTAATTTCATAACTTGCCTGCAAACCGCGAGACGAATCTTTTGAGCCTAATTAATCCGTCATTAGCACGTGTGGGTTACTGTAGCACTTA[T/C]
GGCTAATCATAGACTAATTAGGCTAAAAAGATTCGACTCGCGATTTCTCCCCTAACTGTGTAATTAGTTTTTAAATTTATCTATATTTAATACTTAATGC
GCATTAAGTATTAAATATAGATAAATTTAAAAACTAATTACACAGTTAGGGGAGAAATCGCGAGTCGAATCTTTTTAGCCTAATTAGTCTATGATTAGCC[A/G]
TAAGTGCTACAGTAACCCACACGTGCTAATGACGGATTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTGCAGGCAAGTTATGAAATTAGTTTTTTCATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 2.10% | 0.61% | 4.44% | NA |
| All Indica | 2759 | 98.90% | 0.10% | 0.91% | 0.07% | NA |
| All Japonica | 1512 | 79.90% | 6.30% | 0.20% | 13.62% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 0.20% | 4.09% | 0.22% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.10% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 67.30% | 7.60% | 0.39% | 24.77% | NA |
| Tropical Japonica | 504 | 93.50% | 4.40% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 91.70% | 6.20% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405244056 | T -> C | LOC_Os04g09770.1 | upstream_gene_variant ; 736.0bp to feature; MODIFIER | silent_mutation | Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0405244056 | T -> C | LOC_Os04g09780.1 | downstream_gene_variant ; 2790.0bp to feature; MODIFIER | silent_mutation | Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0405244056 | T -> C | LOC_Os04g09770-LOC_Os04g09780 | intergenic_region ; MODIFIER | silent_mutation | Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0405244056 | T -> DEL | N | N | silent_mutation | Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405244056 | 6.31E-07 | NA | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | NA | 3.36E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | 1.40E-10 | NA | mr1062 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | 1.18E-07 | 1.12E-09 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | 5.86E-07 | 1.01E-07 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | 7.90E-06 | 7.90E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | NA | 9.07E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | 1.51E-06 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | NA | 4.70E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | 4.44E-07 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | NA | 5.83E-08 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405244056 | NA | 8.06E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |