Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405244056:

Variant ID: vg0405244056 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5244056
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGAAAAAACTAATTTCATAACTTGCCTGCAAACCGCGAGACGAATCTTTTGAGCCTAATTAATCCGTCATTAGCACGTGTGGGTTACTGTAGCACTTA[T/C]
GGCTAATCATAGACTAATTAGGCTAAAAAGATTCGACTCGCGATTTCTCCCCTAACTGTGTAATTAGTTTTTAAATTTATCTATATTTAATACTTAATGC

Reverse complement sequence

GCATTAAGTATTAAATATAGATAAATTTAAAAACTAATTACACAGTTAGGGGAGAAATCGCGAGTCGAATCTTTTTAGCCTAATTAGTCTATGATTAGCC[A/G]
TAAGTGCTACAGTAACCCACACGTGCTAATGACGGATTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTGCAGGCAAGTTATGAAATTAGTTTTTTCATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	2.10%	0.61%	4.44%	NA
All Indica	2759	98.90%	0.10%	0.91%	0.07%	NA
All Japonica	1512	79.90%	6.30%	0.20%	13.62%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.50%	0.20%	4.09%	0.22%	NA
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	99.20%	0.10%	0.51%	0.13%	NA
Temperate Japonica	767	67.30%	7.60%	0.39%	24.77%	NA
Tropical Japonica	504	93.50%	4.40%	0.00%	2.18%	NA
Japonica Intermediate	241	91.70%	6.20%	0.00%	2.07%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	3.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405244056	T -> C	LOC_Os04g09770.1	upstream_gene_variant ; 736.0bp to feature; MODIFIER	silent_mutation	Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0405244056	T -> C	LOC_Os04g09780.1	downstream_gene_variant ; 2790.0bp to feature; MODIFIER	silent_mutation	Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0405244056	T -> C	LOC_Os04g09770-LOC_Os04g09780	intergenic_region ; MODIFIER	silent_mutation	Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0405244056	T -> DEL	N	N	silent_mutation	Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405244056	6.31E-07	NA	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	NA	3.36E-07	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	1.40E-10	NA	mr1062	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	1.18E-07	1.12E-09	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	5.86E-07	1.01E-07	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	7.90E-06	7.90E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	NA	9.07E-06	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	1.51E-06	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	NA	4.70E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	4.44E-07	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	NA	5.83E-08	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056	NA	8.06E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251