\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405244056:

Variant ID: vg0405244056 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5244056
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGAAAAAACTAATTTCATAACTTGCCTGCAAACCGCGAGACGAATCTTTTGAGCCTAATTAATCCGTCATTAGCACGTGTGGGTTACTGTAGCACTTA[T/C]
GGCTAATCATAGACTAATTAGGCTAAAAAGATTCGACTCGCGATTTCTCCCCTAACTGTGTAATTAGTTTTTAAATTTATCTATATTTAATACTTAATGC

Reverse complement sequence

GCATTAAGTATTAAATATAGATAAATTTAAAAACTAATTACACAGTTAGGGGAGAAATCGCGAGTCGAATCTTTTTAGCCTAATTAGTCTATGATTAGCC[A/G]
TAAGTGCTACAGTAACCCACACGTGCTAATGACGGATTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTGCAGGCAAGTTATGAAATTAGTTTTTTCATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 2.10% 0.61% 4.44% NA
All Indica  2759 98.90% 0.10% 0.91% 0.07% NA
All Japonica  1512 79.90% 6.30% 0.20% 13.62% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.50% 0.20% 4.09% 0.22% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 99.20% 0.10% 0.51% 0.13% NA
Temperate Japonica  767 67.30% 7.60% 0.39% 24.77% NA
Tropical Japonica  504 93.50% 4.40% 0.00% 2.18% NA
Japonica Intermediate  241 91.70% 6.20% 0.00% 2.07% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 94.40% 3.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405244056 T -> C LOC_Os04g09770.1 upstream_gene_variant ; 736.0bp to feature; MODIFIER silent_mutation Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0405244056 T -> C LOC_Os04g09780.1 downstream_gene_variant ; 2790.0bp to feature; MODIFIER silent_mutation Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0405244056 T -> C LOC_Os04g09770-LOC_Os04g09780 intergenic_region ; MODIFIER silent_mutation Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0405244056 T -> DEL N N silent_mutation Average:34.496; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405244056 6.31E-07 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 NA 3.36E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 1.40E-10 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 1.18E-07 1.12E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 5.86E-07 1.01E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 7.90E-06 7.90E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 NA 9.07E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 1.51E-06 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 NA 4.70E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 4.44E-07 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 NA 5.83E-08 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405244056 NA 8.06E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251