\
| Variant ID: vg0405232290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5232290 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAGATTGTTTCCTAGAAGACCATGCAATCAATGATGTACCAAGAAAATGACATGTTCCACTGGTACTTTTCCTATCAATTCTACAACCACCAAAATCAG[C/T]
ATCAAAATATCCACTCAAGCATATAGAAGATGAAGTAGAATACCAAATTCCAAACTCAAGTGTATGATTCAAATACCTCATTATTCGCTTGACCGTTTGA
TCAAACGGTCAAGCGAATAATGAGGTATTTGAATCATACACTTGAGTTTGGAATTTGGTATTCTACTTCATCTTCTATATGCTTGAGTGGATATTTTGAT[G/A]
CTGATTTTGGTGGTTGTAGAATTGATAGGAAAAGTACCAGTGGAACATGTCATTTTCTTGGTACATCATTGATTGCATGGTCTTCTAGGAAACAATCTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 4.90% | 9.52% | 35.59% | NA |
| All Indica | 2759 | 40.00% | 0.10% | 14.82% | 45.05% | NA |
| All Japonica | 1512 | 73.10% | 14.90% | 0.99% | 11.04% | NA |
| Aus | 269 | 32.30% | 0.00% | 3.72% | 63.94% | NA |
| Indica I | 595 | 33.60% | 0.00% | 14.12% | 52.27% | NA |
| Indica II | 465 | 42.60% | 0.20% | 6.24% | 50.97% | NA |
| Indica III | 913 | 43.20% | 0.00% | 18.95% | 37.90% | NA |
| Indica Intermediate | 786 | 39.70% | 0.30% | 15.65% | 44.40% | NA |
| Temperate Japonica | 767 | 65.30% | 27.10% | 0.39% | 7.17% | NA |
| Tropical Japonica | 504 | 78.00% | 2.40% | 1.98% | 17.66% | NA |
| Japonica Intermediate | 241 | 87.60% | 2.10% | 0.83% | 9.54% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 6.25% | 72.92% | NA |
| Intermediate | 90 | 51.10% | 4.40% | 11.11% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405232290 | C -> DEL | N | N | silent_mutation | Average:11.394; most accessible tissue: Minghui63 flower, score: 17.838 | N | N | N | N |
| vg0405232290 | C -> T | LOC_Os04g09750.1 | downstream_gene_variant ; 3418.0bp to feature; MODIFIER | silent_mutation | Average:11.394; most accessible tissue: Minghui63 flower, score: 17.838 | N | N | N | N |
| vg0405232290 | C -> T | LOC_Os04g09750-LOC_Os04g09770 | intergenic_region ; MODIFIER | silent_mutation | Average:11.394; most accessible tissue: Minghui63 flower, score: 17.838 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405232290 | 6.73E-08 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405232290 | 2.38E-06 | 7.62E-09 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405232290 | 8.16E-07 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405232290 | NA | 1.31E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405232290 | 1.22E-06 | NA | mr1631_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405232290 | NA | 2.83E-07 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |