\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405227428:

Variant ID: vg0405227428 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5227428
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGCCTATTTAAAGAGCTCCTCTTCTCACTTCACTCACACACCTCAAGCAAAGCTCTCTCATATTCTCTTAAGTTTAGTTTAGTGTTCTTAAGCTAAT[G/A,T]
GAGTAGGAATAGAGTAGAAATCGGAGTCCGGAAGCCTTCGGAAGAGTTCGGGTATGGCTCTAGCAGCATTAGTTTCCTCTTTTGTAAGCTTTGTACTTTT

Reverse complement sequence

AAAAGTACAAAGCTTACAAAAGAGGAAACTAATGCTGCTAGAGCCATACCCGAACTCTTCCGAAGGCTTCCGGACTCCGATTTCTACTCTATTCCTACTC[C/T,A]
ATTAGCTTAAGAACACTAAACTAAACTTAAGAGAATATGAGAGAGCTTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGAGGAGCTCTTTAAATAGGCAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 30.60% 17.29% 4.23% T: 0.02%
All Indica  2759 37.30% 35.80% 23.67% 3.26% T: 0.04%
All Japonica  1512 64.20% 27.40% 7.01% 1.39% NA
Aus  269 59.50% 3.00% 12.64% 24.91% NA
Indica I  595 45.40% 22.70% 31.26% 0.67% NA
Indica II  465 28.80% 43.90% 23.01% 4.30% NA
Indica III  913 38.30% 38.30% 19.06% 4.16% T: 0.11%
Indica Intermediate  786 34.90% 37.90% 23.66% 3.56% NA
Temperate Japonica  767 87.10% 7.40% 5.22% 0.26% NA
Tropical Japonica  504 28.40% 57.50% 11.11% 2.98% NA
Japonica Intermediate  241 66.40% 27.80% 4.15% 1.66% NA
VI/Aromatic  96 64.60% 11.50% 7.29% 16.67% NA
Intermediate  90 44.40% 30.00% 18.89% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405227428 G -> DEL N N silent_mutation Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0405227428 G -> A LOC_Os04g09730.1 downstream_gene_variant ; 4951.0bp to feature; MODIFIER silent_mutation Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0405227428 G -> A LOC_Os04g09740.1 downstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0405227428 G -> A LOC_Os04g09750.1 intron_variant ; MODIFIER silent_mutation Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0405227428 G -> T LOC_Os04g09730.1 downstream_gene_variant ; 4951.0bp to feature; MODIFIER silent_mutation Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0405227428 G -> T LOC_Os04g09740.1 downstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0405227428 G -> T LOC_Os04g09750.1 intron_variant ; MODIFIER silent_mutation Average:32.989; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405227428 8.65E-07 8.64E-07 mr1407_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405227428 NA 6.57E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251