\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405223882:

Variant ID: vg0405223882 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5223882
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAACACTGCAAGAATAAGATAAGATGCAATCTAAATATTGCGAATAGGTGATTAAGCACAAAGAAATAGTTGCGATTGAAGTGGTAGATCTAATTGACC[C/T]
GGCAAATCAACACACCAACTATTGGGAGCTCTGAATCAACAGTCGCCGACTAATCGAACGAGGACTAGAGACAAGGTGAATGGCACTTGGTAAAATTCAA

Reverse complement sequence

TTGAATTTTACCAAGTGCCATTCACCTTGTCTCTAGTCCTCGTTCGATTAGTCGGCGACTGTTGATTCAGAGCTCCCAATAGTTGGTGTGTTGATTTGCC[G/A]
GGTCAATTAGATCTACCACTTCAATCGCAACTATTTCTTTGTGCTTAATCACCTATTCGCAATATTTAGATTGCATCTTATCTTATTCTTGCAGTGTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 9.10% 4.23% 47.80% NA
All Indica  2759 22.70% 2.30% 5.84% 69.23% NA
All Japonica  1512 65.50% 22.90% 1.12% 10.45% NA
Aus  269 36.10% 0.40% 6.69% 56.88% NA
Indica I  595 23.90% 3.50% 4.87% 67.73% NA
Indica II  465 20.60% 1.10% 4.52% 73.76% NA
Indica III  913 21.50% 1.60% 7.34% 69.55% NA
Indica Intermediate  786 24.30% 2.80% 5.60% 67.30% NA
Temperate Japonica  767 90.50% 2.00% 0.26% 7.30% NA
Tropical Japonica  504 25.40% 56.20% 2.58% 15.87% NA
Japonica Intermediate  241 70.10% 19.90% 0.83% 9.13% NA
VI/Aromatic  96 85.40% 6.20% 0.00% 8.33% NA
Intermediate  90 47.80% 14.40% 4.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405223882 C -> DEL N N silent_mutation Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg0405223882 C -> T LOC_Os04g09740.1 upstream_gene_variant ; 641.0bp to feature; MODIFIER silent_mutation Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg0405223882 C -> T LOC_Os04g09750.1 upstream_gene_variant ; 3188.0bp to feature; MODIFIER silent_mutation Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg0405223882 C -> T LOC_Os04g09730.1 downstream_gene_variant ; 1405.0bp to feature; MODIFIER silent_mutation Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg0405223882 C -> T LOC_Os04g09730-LOC_Os04g09740 intergenic_region ; MODIFIER silent_mutation Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405223882 1.28E-06 3.35E-13 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882 NA 5.39E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882 NA 1.76E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882 NA 1.48E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882 NA 7.34E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882 NA 2.81E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882 NA 4.58E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251