Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405223882:

Variant ID: vg0405223882 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5223882
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAACACTGCAAGAATAAGATAAGATGCAATCTAAATATTGCGAATAGGTGATTAAGCACAAAGAAATAGTTGCGATTGAAGTGGTAGATCTAATTGACC[C/T]
GGCAAATCAACACACCAACTATTGGGAGCTCTGAATCAACAGTCGCCGACTAATCGAACGAGGACTAGAGACAAGGTGAATGGCACTTGGTAAAATTCAA

Reverse complement sequence

TTGAATTTTACCAAGTGCCATTCACCTTGTCTCTAGTCCTCGTTCGATTAGTCGGCGACTGTTGATTCAGAGCTCCCAATAGTTGGTGTGTTGATTTGCC[G/A]
GGTCAATTAGATCTACCACTTCAATCGCAACTATTTCTTTGTGCTTAATCACCTATTCGCAATATTTAGATTGCATCTTATCTTATTCTTGCAGTGTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	9.10%	4.23%	47.80%	NA
All Indica	2759	22.70%	2.30%	5.84%	69.23%	NA
All Japonica	1512	65.50%	22.90%	1.12%	10.45%	NA
Aus	269	36.10%	0.40%	6.69%	56.88%	NA
Indica I	595	23.90%	3.50%	4.87%	67.73%	NA
Indica II	465	20.60%	1.10%	4.52%	73.76%	NA
Indica III	913	21.50%	1.60%	7.34%	69.55%	NA
Indica Intermediate	786	24.30%	2.80%	5.60%	67.30%	NA
Temperate Japonica	767	90.50%	2.00%	0.26%	7.30%	NA
Tropical Japonica	504	25.40%	56.20%	2.58%	15.87%	NA
Japonica Intermediate	241	70.10%	19.90%	0.83%	9.13%	NA
VI/Aromatic	96	85.40%	6.20%	0.00%	8.33%	NA
Intermediate	90	47.80%	14.40%	4.44%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405223882	C -> DEL	N	N	silent_mutation	Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg0405223882	C -> T	LOC_Os04g09740.1	upstream_gene_variant ; 641.0bp to feature; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg0405223882	C -> T	LOC_Os04g09750.1	upstream_gene_variant ; 3188.0bp to feature; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg0405223882	C -> T	LOC_Os04g09730.1	downstream_gene_variant ; 1405.0bp to feature; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg0405223882	C -> T	LOC_Os04g09730-LOC_Os04g09740	intergenic_region ; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405223882	1.28E-06	3.35E-13	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882	NA	5.39E-19	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882	NA	1.76E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882	NA	1.48E-07	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882	NA	7.34E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882	NA	2.81E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223882	NA	4.58E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251