\
| Variant ID: vg0405223882 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5223882 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGAACACTGCAAGAATAAGATAAGATGCAATCTAAATATTGCGAATAGGTGATTAAGCACAAAGAAATAGTTGCGATTGAAGTGGTAGATCTAATTGACC[C/T]
GGCAAATCAACACACCAACTATTGGGAGCTCTGAATCAACAGTCGCCGACTAATCGAACGAGGACTAGAGACAAGGTGAATGGCACTTGGTAAAATTCAA
TTGAATTTTACCAAGTGCCATTCACCTTGTCTCTAGTCCTCGTTCGATTAGTCGGCGACTGTTGATTCAGAGCTCCCAATAGTTGGTGTGTTGATTTGCC[G/A]
GGTCAATTAGATCTACCACTTCAATCGCAACTATTTCTTTGTGCTTAATCACCTATTCGCAATATTTAGATTGCATCTTATCTTATTCTTGCAGTGTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.90% | 9.10% | 4.23% | 47.80% | NA |
| All Indica | 2759 | 22.70% | 2.30% | 5.84% | 69.23% | NA |
| All Japonica | 1512 | 65.50% | 22.90% | 1.12% | 10.45% | NA |
| Aus | 269 | 36.10% | 0.40% | 6.69% | 56.88% | NA |
| Indica I | 595 | 23.90% | 3.50% | 4.87% | 67.73% | NA |
| Indica II | 465 | 20.60% | 1.10% | 4.52% | 73.76% | NA |
| Indica III | 913 | 21.50% | 1.60% | 7.34% | 69.55% | NA |
| Indica Intermediate | 786 | 24.30% | 2.80% | 5.60% | 67.30% | NA |
| Temperate Japonica | 767 | 90.50% | 2.00% | 0.26% | 7.30% | NA |
| Tropical Japonica | 504 | 25.40% | 56.20% | 2.58% | 15.87% | NA |
| Japonica Intermediate | 241 | 70.10% | 19.90% | 0.83% | 9.13% | NA |
| VI/Aromatic | 96 | 85.40% | 6.20% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 47.80% | 14.40% | 4.44% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405223882 | C -> DEL | N | N | silent_mutation | Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg0405223882 | C -> T | LOC_Os04g09740.1 | upstream_gene_variant ; 641.0bp to feature; MODIFIER | silent_mutation | Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg0405223882 | C -> T | LOC_Os04g09750.1 | upstream_gene_variant ; 3188.0bp to feature; MODIFIER | silent_mutation | Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg0405223882 | C -> T | LOC_Os04g09730.1 | downstream_gene_variant ; 1405.0bp to feature; MODIFIER | silent_mutation | Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg0405223882 | C -> T | LOC_Os04g09730-LOC_Os04g09740 | intergenic_region ; MODIFIER | silent_mutation | Average:21.1; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405223882 | 1.28E-06 | 3.35E-13 | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405223882 | NA | 5.39E-19 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405223882 | NA | 1.76E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405223882 | NA | 1.48E-07 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405223882 | NA | 7.34E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405223882 | NA | 2.81E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405223882 | NA | 4.58E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |