Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405223650:

Variant ID: vg0405223650 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5223650
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTACAAAACTAAAATCCTTACCAGGCAATTGAAGCTCTGGTACCAACTGATGACGCTCTCTCTCGTGGCCCGATCTTCTGGTGAGGGGATAATTCTCG[C/T]
TGTGATCGAGTGCGACGTTTGCGACGTGGCTACCAACCAGAACATATCCAGGACGCCGTGCAATCGCTACACCACAAACGATGTCGTACCAACCGTGACG

Reverse complement sequence

CGTCACGGTTGGTACGACATCGTTTGTGGTGTAGCGATTGCACGGCGTCCTGGATATGTTCTGGTTGGTAGCCACGTCGCAAACGTCGCACTCGATCACA[G/A]
CGAGAATTATCCCCTCACCAGAAGATCGGGCCACGAGAGAGAGCGTCATCAGTTGGTACCAGAGCTTCAATTGCCTGGTAAGGATTTTAGTTTTGTAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.30%	10.60%	0.59%	66.50%	NA
All Indica	2759	5.00%	2.40%	0.47%	92.13%	NA
All Japonica	1512	58.90%	27.30%	0.13%	13.62%	NA
Aus	269	0.00%	0.40%	0.00%	99.63%	NA
Indica I	595	3.50%	3.50%	0.67%	92.27%	NA
Indica II	465	12.30%	1.30%	0.86%	85.59%	NA
Indica III	913	0.70%	1.80%	0.00%	97.59%	NA
Indica Intermediate	786	7.00%	2.80%	0.64%	89.57%	NA
Temperate Japonica	767	84.90%	7.20%	0.00%	7.95%	NA
Tropical Japonica	504	17.70%	59.10%	0.40%	22.82%	NA
Japonica Intermediate	241	62.70%	24.90%	0.00%	12.45%	NA
VI/Aromatic	96	1.00%	8.30%	12.50%	78.12%	NA
Intermediate	90	25.60%	15.60%	1.11%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405223650	C -> DEL	N	N	silent_mutation	Average:25.861; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0405223650	C -> T	LOC_Os04g09740.1	upstream_gene_variant ; 873.0bp to feature; MODIFIER	silent_mutation	Average:25.861; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0405223650	C -> T	LOC_Os04g09750.1	upstream_gene_variant ; 3420.0bp to feature; MODIFIER	silent_mutation	Average:25.861; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0405223650	C -> T	LOC_Os04g09730.1	downstream_gene_variant ; 1173.0bp to feature; MODIFIER	silent_mutation	Average:25.861; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0405223650	C -> T	LOC_Os04g09730-LOC_Os04g09740	intergenic_region ; MODIFIER	silent_mutation	Average:25.861; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405223650	NA	9.30E-06	mr1388	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	2.81E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	4.86E-08	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	1.51E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	8.00E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	3.15E-10	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	6.88E-07	mr1388_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	1.55E-07	1.69E-17	mr1416_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	1.84E-09	1.10E-10	mr1416_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	1.50E-09	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	3.63E-07	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	7.39E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	2.43E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405223650	NA	1.05E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251