\
| Variant ID: vg0405169454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5169454 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCTATTTAGGATTAAAGAAACTAAACAAAAAGTACATTGAAAGCTTGAAGGGTACGTGGGAAACCATTGTATCAGAAACGGTGTTGTCTATCGAAGCCTT[A/G]
AAGGATCTCTGATATTGAAAGCTTTTGTAAAGTTTAGGCATACCATAGGCAAAGTCAAACAAATAAATAGTAATTTGTTAAAAGAAAAATACTTGAGAAG
CTTCTCAAGTATTTTTCTTTTAACAAATTACTATTTATTTGTTTGACTTTGCCTATGGTATGCCTAAACTTTACAAAAGCTTTCAATATCAGAGATCCTT[T/C]
AAGGCTTCGATAGACAACACCGTTTCTGATACAATGGTTTCCCACGTACCCTTCAAGCTTTCAATGTACTTTTTGTTTAGTTTCTTTAATCCTAAATAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 4.60% | 0.15% | 3.03% | NA |
| All Indica | 2759 | 97.30% | 0.00% | 0.14% | 2.54% | NA |
| All Japonica | 1512 | 81.00% | 14.10% | 0.13% | 4.76% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.00% | 0.67% | NA |
| Indica II | 465 | 94.20% | 0.00% | 0.22% | 5.59% | NA |
| Indica III | 913 | 98.70% | 0.00% | 0.11% | 1.20% | NA |
| Indica Intermediate | 786 | 95.90% | 0.10% | 0.25% | 3.69% | NA |
| Temperate Japonica | 767 | 74.20% | 25.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 83.30% | 2.20% | 0.40% | 14.09% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405169454 | A -> DEL | N | N | silent_mutation | Average:30.843; most accessible tissue: Callus, score: 73.188 | N | N | N | N |
| vg0405169454 | A -> G | LOC_Os04g09604.1 | downstream_gene_variant ; 1960.0bp to feature; MODIFIER | silent_mutation | Average:30.843; most accessible tissue: Callus, score: 73.188 | N | N | N | N |
| vg0405169454 | A -> G | LOC_Os04g09620.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.843; most accessible tissue: Callus, score: 73.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405169454 | 2.13E-06 | 5.08E-07 | mr1035 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405169454 | 2.53E-07 | 2.47E-12 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405169454 | 3.10E-06 | 3.10E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405169454 | NA | 6.16E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405169454 | 9.87E-06 | 3.11E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405169454 | NA | 9.54E-08 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405169454 | 5.59E-07 | 2.19E-09 | mr1631_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |