\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405169454:

Variant ID: vg0405169454 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5169454
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTATTTAGGATTAAAGAAACTAAACAAAAAGTACATTGAAAGCTTGAAGGGTACGTGGGAAACCATTGTATCAGAAACGGTGTTGTCTATCGAAGCCTT[A/G]
AAGGATCTCTGATATTGAAAGCTTTTGTAAAGTTTAGGCATACCATAGGCAAAGTCAAACAAATAAATAGTAATTTGTTAAAAGAAAAATACTTGAGAAG

Reverse complement sequence

CTTCTCAAGTATTTTTCTTTTAACAAATTACTATTTATTTGTTTGACTTTGCCTATGGTATGCCTAAACTTTACAAAAGCTTTCAATATCAGAGATCCTT[T/C]
AAGGCTTCGATAGACAACACCGTTTCTGATACAATGGTTTCCCACGTACCCTTCAAGCTTTCAATGTACTTTTTGTTTAGTTTCTTTAATCCTAAATAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 4.60% 0.15% 3.03% NA
All Indica  2759 97.30% 0.00% 0.14% 2.54% NA
All Japonica  1512 81.00% 14.10% 0.13% 4.76% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.00% 0.67% NA
Indica II  465 94.20% 0.00% 0.22% 5.59% NA
Indica III  913 98.70% 0.00% 0.11% 1.20% NA
Indica Intermediate  786 95.90% 0.10% 0.25% 3.69% NA
Temperate Japonica  767 74.20% 25.70% 0.00% 0.13% NA
Tropical Japonica  504 83.30% 2.20% 0.40% 14.09% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405169454 A -> DEL N N silent_mutation Average:30.843; most accessible tissue: Callus, score: 73.188 N N N N
vg0405169454 A -> G LOC_Os04g09604.1 downstream_gene_variant ; 1960.0bp to feature; MODIFIER silent_mutation Average:30.843; most accessible tissue: Callus, score: 73.188 N N N N
vg0405169454 A -> G LOC_Os04g09620.1 intron_variant ; MODIFIER silent_mutation Average:30.843; most accessible tissue: Callus, score: 73.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405169454 2.13E-06 5.08E-07 mr1035 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405169454 2.53E-07 2.47E-12 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405169454 3.10E-06 3.10E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405169454 NA 6.16E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405169454 9.87E-06 3.11E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405169454 NA 9.54E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405169454 5.59E-07 2.19E-09 mr1631_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251