\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405151676:

Variant ID: vg0405151676 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 5151676
Reference Allele: TAlternative Allele: A,TA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.26, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GACGATCCGCGCAAAAAAAAAAATTAAAATGGGGACGAGTGAATATATGTAGGCAATATACGTTATGTGGATGGACCCATTTTAGTACACGGGAAAGTTT[T/A,TA]
TATATATATATTTTTTAAAAAAACTTTAGTTGAAGTTGTAGTGGCATATAAGAAATAAGCTATTCTAAACAAGTTGCCTGGCAGGTGGACCTAACAGATG

Reverse complement sequence

CATCTGTTAGGTCCACCTGCCAGGCAACTTGTTTAGAATAGCTTATTTCTTATATGCCACTACAACTTCAACTAAAGTTTTTTTAAAAAATATATATATA[A/T,TA]
AAACTTTCCCGTGTACTAAAATGGGTCCATCCACATAACGTATATTGCCTACATATATTCACTCGTCCCCATTTTAATTTTTTTTTTTGCGCGGATCGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 31.90% 0.93% 0.87% TA: 0.13%
All Indica  2759 58.50% 38.70% 1.38% 1.30% TA: 0.14%
All Japonica  1512 74.20% 25.10% 0.33% 0.20% TA: 0.13%
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 67.60% 30.10% 0.34% 2.02% NA
Indica II  465 35.70% 58.30% 4.30% 1.72% NA
Indica III  913 59.60% 40.10% 0.11% 0.00% TA: 0.22%
Indica Intermediate  786 63.70% 32.10% 1.91% 2.04% TA: 0.25%
Temperate Japonica  767 63.80% 35.60% 0.26% 0.13% TA: 0.26%
Tropical Japonica  504 80.40% 18.80% 0.60% 0.20% NA
Japonica Intermediate  241 94.60% 5.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405151676 T -> DEL N N silent_mutation Average:63.018; most accessible tissue: Minghui63 root, score: 95.404 N N N N
vg0405151676 T -> A LOC_Os04g09590.1 downstream_gene_variant ; 413.0bp to feature; MODIFIER silent_mutation Average:63.018; most accessible tissue: Minghui63 root, score: 95.404 N N N N
vg0405151676 T -> A LOC_Os04g09580-LOC_Os04g09590 intergenic_region ; MODIFIER silent_mutation Average:63.018; most accessible tissue: Minghui63 root, score: 95.404 N N N N
vg0405151676 T -> TA LOC_Os04g09590.1 downstream_gene_variant ; 412.0bp to feature; MODIFIER silent_mutation Average:63.018; most accessible tissue: Minghui63 root, score: 95.404 N N N N
vg0405151676 T -> TA LOC_Os04g09580-LOC_Os04g09590 intergenic_region ; MODIFIER silent_mutation Average:63.018; most accessible tissue: Minghui63 root, score: 95.404 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0405151676 T A 0.05 -0.02 -0.02 -0.01 0.0 -0.01
vg0405151676 T TA -0.02 0.11 0.06 0.05 0.06 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405151676 3.33E-07 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405151676 NA 3.16E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405151676 NA 7.54E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405151676 8.01E-06 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405151676 NA 2.01E-09 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405151676 2.16E-06 2.16E-06 mr1525_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405151676 3.11E-06 1.65E-07 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251