RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0405137895:

Variant ID: vg0405137895 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5137895
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.45, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CATTGCAATTAAATCTTTACAACAAGACCACACATAATTATATTTCGACAAAAAAATATTTTAGCTTCTCTATTGATATTTTTTTAATGTTGCATATGAT[G/A]
ATCAAATGTTGCAGTGGATTTTGATATTATGGAACACGCCGTTGTAACAAATCACCTACATATTTTGGAAACCCCTATTAAGGGAATTTGGTTTATTTTT

Reverse complement sequence

AAAAATAAACCAAATTCCCTTAATAGGGGTTTCCAAAATATGTAGGTGATTTGTTACAACGGCGTGTTCCATAATATCAAAATCCACTGCAACATTTGAT[C/T]
ATCATATGCAACATTAAAAAAATATCAATAGAGAAGCTAAAATATTTTTTTGTCGAAATATAATTATGTGTGGTCTTGTTGTAAAGATTTAATTGCAATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	46.70%	0.15%	2.90%	NA
All Indica	2759	51.60%	45.60%	0.18%	2.61%	NA
All Japonica	1512	38.60%	57.20%	0.07%	4.10%	NA
Aus	269	85.90%	13.80%	0.00%	0.37%	NA
Indica I	595	64.90%	34.30%	0.17%	0.67%	NA
Indica II	465	67.30%	26.00%	0.22%	6.45%	NA
Indica III	913	27.20%	71.90%	0.11%	0.88%	NA
Indica Intermediate	786	60.60%	35.40%	0.25%	3.82%	NA
Temperate Japonica	767	42.90%	56.80%	0.13%	0.13%	NA
Tropical Japonica	504	20.00%	67.90%	0.00%	12.10%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	7.30%	1.04%	0.00%	NA
Intermediate	90	56.70%	41.10%	0.00%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405137895	G -> DEL	N	N	silent_mutation	Average:29.051; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0405137895	G -> A	LOC_Os04g09580.1	3_prime_UTR_variant ; 2354.0bp to feature; MODIFIER	silent_mutation	Average:29.051; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0405137895	G -> A	LOC_Os04g09570.1	downstream_gene_variant ; 1517.0bp to feature; MODIFIER	silent_mutation	Average:29.051; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405137895	NA	7.94E-06	mr1554	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405137895	NA	7.44E-08	mr1602	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405137895	NA	1.19E-06	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0405137895:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact