\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405116940:

Variant ID: vg0405116940 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 5116940
Reference Allele: AAlternative Allele: G,ATTG,ATTTG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATTTACTGTAGCACCACATTGTCATATCATGGAGCAATTAGGCTTAAAAGATTCGTCTCGCAATTTACACGCAATCTGTATAATTAGTTATTTTTTC[A/G,ATTG,ATTTG]
TTTATATTTAATACTCTATATATGTGTCCAAACATTCGATGTAACAGGGTGAAAATTTTTGCCAGGAGATCTAAATAGAGCCTAAGATGATCACATGGTA

Reverse complement sequence

TACCATGTGATCATCTTAGGCTCTATTTAGATCTCCTGGCAAAAATTTTCACCCTGTTACATCGAATGTTTGGACACATATATAGAGTATTAAATATAAA[T/C,CAAT,CAAAT]
GAAAAAATAACTAATTATACAGATTGCGTGTAAATTGCGAGACGAATCTTTTAAGCCTAATTGCTCCATGATATGACAATGTGGTGCTACAGTAAATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 13.80% 0.34% 0.00% ATTG: 2.52%; ATTTG: 0.04%
All Indica  2759 93.70% 3.80% 0.07% 0.00% ATTG: 2.36%; ATTTG: 0.07%
All Japonica  1512 60.50% 35.30% 0.79% 0.00% ATTG: 3.37%
Aus  269 98.90% 0.70% 0.00% 0.00% ATTG: 0.37%
Indica I  595 95.60% 3.50% 0.17% 0.00% ATTG: 0.67%
Indica II  465 91.40% 1.50% 0.00% 0.00% ATTG: 6.67%; ATTTG: 0.43%
Indica III  913 99.20% 0.70% 0.00% 0.00% ATTG: 0.11%
Indica Intermediate  786 87.30% 8.90% 0.13% 0.00% ATTG: 3.69%
Temperate Japonica  767 58.50% 41.20% 0.13% 0.00% ATTG: 0.13%
Tropical Japonica  504 72.20% 15.70% 2.18% 0.00% ATTG: 9.92%
Japonica Intermediate  241 42.30% 57.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 11.10% 2.22% 0.00% ATTG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405116940 A -> G LOC_Os04g09530.1 upstream_gene_variant ; 3302.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> G LOC_Os04g09540.1 upstream_gene_variant ; 4087.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> G LOC_Os04g09530.2 upstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> G LOC_Os04g09530-LOC_Os04g09540 intergenic_region ; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTTG LOC_Os04g09530.1 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTTG LOC_Os04g09540.1 upstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTTG LOC_Os04g09530.2 upstream_gene_variant ; 3225.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTTG LOC_Os04g09530-LOC_Os04g09540 intergenic_region ; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTG LOC_Os04g09530.1 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTG LOC_Os04g09540.1 upstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTG LOC_Os04g09530.2 upstream_gene_variant ; 3225.0bp to feature; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0405116940 A -> ATTG LOC_Os04g09530-LOC_Os04g09540 intergenic_region ; MODIFIER silent_mutation Average:48.968; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405116940 9.34E-07 NA mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116940 NA 3.80E-07 mr1602 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251