\
| Variant ID: vg0405089971 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5089971 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
CGTTGGATGTTTCATAGAGTGGTGGATATCCTGTACAATCTAAGACAACATAGATATTTAACCTAATCAGCTGCCTTCCAATGATAGATGTTAGCCGATT[G/A]
AAGGTTAAATAACGGTATTTTTGAAGATTATACAGAATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGATGGAAGCACTAAT
ATTAGTGCTTCCATCTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATTCTGTATAATCTTCAAAAATACCGTTATTTAACCTT[C/T]
AATCGGCTAACATCTATCATTGGAAGGCAGCTGATTAGGTTAAATATCTATGTTGTCTTAGATTGTACAGGATATCCACCACTCTATGAAACATCCAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 6.00% | 1.08% | 2.16% | NA |
| All Indica | 2759 | 97.70% | 0.30% | 0.43% | 1.59% | NA |
| All Japonica | 1512 | 75.80% | 18.10% | 2.45% | 3.70% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.17% | 0.34% | NA |
| Indica II | 465 | 93.10% | 0.90% | 1.08% | 4.95% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 96.70% | 0.30% | 0.76% | 2.29% | NA |
| Temperate Japonica | 767 | 63.90% | 32.70% | 3.26% | 0.13% | NA |
| Tropical Japonica | 504 | 84.50% | 2.60% | 1.98% | 10.91% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405089971 | G -> DEL | N | N | silent_mutation | Average:14.46; most accessible tissue: Callus, score: 28.144 | N | N | N | N |
| vg0405089971 | G -> A | LOC_Os04g09490.1 | upstream_gene_variant ; 4892.0bp to feature; MODIFIER | silent_mutation | Average:14.46; most accessible tissue: Callus, score: 28.144 | N | N | N | N |
| vg0405089971 | G -> A | LOC_Os04g09500.1 | upstream_gene_variant ; 881.0bp to feature; MODIFIER | silent_mutation | Average:14.46; most accessible tissue: Callus, score: 28.144 | N | N | N | N |
| vg0405089971 | G -> A | LOC_Os04g09510.1 | upstream_gene_variant ; 445.0bp to feature; MODIFIER | silent_mutation | Average:14.46; most accessible tissue: Callus, score: 28.144 | N | N | N | N |
| vg0405089971 | G -> A | LOC_Os04g09500-LOC_Os04g09510 | intergenic_region ; MODIFIER | silent_mutation | Average:14.46; most accessible tissue: Callus, score: 28.144 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405089971 | 1.09E-08 | NA | mr1062 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089971 | 3.82E-06 | 7.30E-10 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089971 | 6.38E-06 | 1.73E-06 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |