\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405089971:

Variant ID: vg0405089971 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5089971
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTGGATGTTTCATAGAGTGGTGGATATCCTGTACAATCTAAGACAACATAGATATTTAACCTAATCAGCTGCCTTCCAATGATAGATGTTAGCCGATT[G/A]
AAGGTTAAATAACGGTATTTTTGAAGATTATACAGAATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGATGGAAGCACTAAT

Reverse complement sequence

ATTAGTGCTTCCATCTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATTCTGTATAATCTTCAAAAATACCGTTATTTAACCTT[C/T]
AATCGGCTAACATCTATCATTGGAAGGCAGCTGATTAGGTTAAATATCTATGTTGTCTTAGATTGTACAGGATATCCACCACTCTATGAAACATCCAACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 6.00% 1.08% 2.16% NA
All Indica  2759 97.70% 0.30% 0.43% 1.59% NA
All Japonica  1512 75.80% 18.10% 2.45% 3.70% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 99.30% 0.20% 0.17% 0.34% NA
Indica II  465 93.10% 0.90% 1.08% 4.95% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 96.70% 0.30% 0.76% 2.29% NA
Temperate Japonica  767 63.90% 32.70% 3.26% 0.13% NA
Tropical Japonica  504 84.50% 2.60% 1.98% 10.91% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405089971 G -> DEL N N silent_mutation Average:14.46; most accessible tissue: Callus, score: 28.144 N N N N
vg0405089971 G -> A LOC_Os04g09490.1 upstream_gene_variant ; 4892.0bp to feature; MODIFIER silent_mutation Average:14.46; most accessible tissue: Callus, score: 28.144 N N N N
vg0405089971 G -> A LOC_Os04g09500.1 upstream_gene_variant ; 881.0bp to feature; MODIFIER silent_mutation Average:14.46; most accessible tissue: Callus, score: 28.144 N N N N
vg0405089971 G -> A LOC_Os04g09510.1 upstream_gene_variant ; 445.0bp to feature; MODIFIER silent_mutation Average:14.46; most accessible tissue: Callus, score: 28.144 N N N N
vg0405089971 G -> A LOC_Os04g09500-LOC_Os04g09510 intergenic_region ; MODIFIER silent_mutation Average:14.46; most accessible tissue: Callus, score: 28.144 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405089971 1.09E-08 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089971 3.82E-06 7.30E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089971 6.38E-06 1.73E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251