\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405089398:

Variant ID: vg0405089398 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5089398
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTAGTTGCCGATGACACATCATTTATCTATGAGCCGATGTCATGTTTGAATCGATCGGCAGATATAAATAAGTAAGAAGAGACTAAATCTACTCGATC[G/A]
GCTGTAGATATTGACAGTATATAATCTCTATGTCGATATATACTTAAATCAAGTAATTGGGATAGATCGGACGCCATGCCGAGACAGTATACAAATCACT

Reverse complement sequence

AGTGATTTGTATACTGTCTCGGCATGGCGTCCGATCTATCCCAATTACTTGATTTAAGTATATATCGACATAGAGATTATATACTGTCAATATCTACAGC[C/T]
GATCGAGTAGATTTAGTCTCTTCTTACTTATTTATATCTGCCGATCGATTCAAACATGACATCGGCTCATAGATAAATGATGTGTCATCGGCAACTAGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 33.40% 0.11% 2.33% NA
All Indica  2759 91.70% 6.40% 0.14% 1.78% NA
All Japonica  1512 6.90% 89.30% 0.07% 3.77% NA
Aus  269 95.20% 4.50% 0.00% 0.37% NA
Indica I  595 95.80% 3.20% 0.00% 1.01% NA
Indica II  465 84.30% 10.30% 0.65% 4.73% NA
Indica III  913 94.10% 5.70% 0.00% 0.22% NA
Indica Intermediate  786 90.10% 7.40% 0.13% 2.42% NA
Temperate Japonica  767 1.00% 98.80% 0.00% 0.13% NA
Tropical Japonica  504 15.90% 73.00% 0.00% 11.11% NA
Japonica Intermediate  241 6.60% 92.90% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 61.10% 35.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405089398 G -> DEL N N silent_mutation Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 N N N N
vg0405089398 G -> A LOC_Os04g09490.1 upstream_gene_variant ; 4319.0bp to feature; MODIFIER silent_mutation Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 N N N N
vg0405089398 G -> A LOC_Os04g09500.1 upstream_gene_variant ; 308.0bp to feature; MODIFIER silent_mutation Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 N N N N
vg0405089398 G -> A LOC_Os04g09510.1 upstream_gene_variant ; 1018.0bp to feature; MODIFIER silent_mutation Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 N N N N
vg0405089398 G -> A LOC_Os04g09500-LOC_Os04g09510 intergenic_region ; MODIFIER silent_mutation Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405089398 NA 1.14E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 4.32E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 1.72E-27 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 9.84E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 5.54E-06 NA mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 1.20E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 4.59E-06 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 6.07E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 5.26E-06 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 6.25E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 4.35E-08 2.65E-10 mr1489_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 1.56E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 1.68E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 3.66E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398 NA 5.23E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251