Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405089398:

Variant ID: vg0405089398 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5089398
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTAGTTGCCGATGACACATCATTTATCTATGAGCCGATGTCATGTTTGAATCGATCGGCAGATATAAATAAGTAAGAAGAGACTAAATCTACTCGATC[G/A]
GCTGTAGATATTGACAGTATATAATCTCTATGTCGATATATACTTAAATCAAGTAATTGGGATAGATCGGACGCCATGCCGAGACAGTATACAAATCACT

Reverse complement sequence

AGTGATTTGTATACTGTCTCGGCATGGCGTCCGATCTATCCCAATTACTTGATTTAAGTATATATCGACATAGAGATTATATACTGTCAATATCTACAGC[C/T]
GATCGAGTAGATTTAGTCTCTTCTTACTTATTTATATCTGCCGATCGATTCAAACATGACATCGGCTCATAGATAAATGATGTGTCATCGGCAACTAGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	33.40%	0.11%	2.33%	NA
All Indica	2759	91.70%	6.40%	0.14%	1.78%	NA
All Japonica	1512	6.90%	89.30%	0.07%	3.77%	NA
Aus	269	95.20%	4.50%	0.00%	0.37%	NA
Indica I	595	95.80%	3.20%	0.00%	1.01%	NA
Indica II	465	84.30%	10.30%	0.65%	4.73%	NA
Indica III	913	94.10%	5.70%	0.00%	0.22%	NA
Indica Intermediate	786	90.10%	7.40%	0.13%	2.42%	NA
Temperate Japonica	767	1.00%	98.80%	0.00%	0.13%	NA
Tropical Japonica	504	15.90%	73.00%	0.00%	11.11%	NA
Japonica Intermediate	241	6.60%	92.90%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	61.10%	35.60%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405089398	G -> DEL	N	N	silent_mutation	Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N
vg0405089398	G -> A	LOC_Os04g09490.1	upstream_gene_variant ; 4319.0bp to feature; MODIFIER	silent_mutation	Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N
vg0405089398	G -> A	LOC_Os04g09500.1	upstream_gene_variant ; 308.0bp to feature; MODIFIER	silent_mutation	Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N
vg0405089398	G -> A	LOC_Os04g09510.1	upstream_gene_variant ; 1018.0bp to feature; MODIFIER	silent_mutation	Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N
vg0405089398	G -> A	LOC_Os04g09500-LOC_Os04g09510	intergenic_region ; MODIFIER	silent_mutation	Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405089398	NA	1.14E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	4.32E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	1.72E-27	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	9.84E-14	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	5.54E-06	NA	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	1.20E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	4.59E-06	NA	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	6.07E-06	NA	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	5.26E-06	NA	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	6.25E-61	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	4.35E-08	2.65E-10	mr1489_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	1.56E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	1.68E-30	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	3.66E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405089398	NA	5.23E-07	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251