\
| Variant ID: vg0405089398 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5089398 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 177. )
AGCTAGTTGCCGATGACACATCATTTATCTATGAGCCGATGTCATGTTTGAATCGATCGGCAGATATAAATAAGTAAGAAGAGACTAAATCTACTCGATC[G/A]
GCTGTAGATATTGACAGTATATAATCTCTATGTCGATATATACTTAAATCAAGTAATTGGGATAGATCGGACGCCATGCCGAGACAGTATACAAATCACT
AGTGATTTGTATACTGTCTCGGCATGGCGTCCGATCTATCCCAATTACTTGATTTAAGTATATATCGACATAGAGATTATATACTGTCAATATCTACAGC[C/T]
GATCGAGTAGATTTAGTCTCTTCTTACTTATTTATATCTGCCGATCGATTCAAACATGACATCGGCTCATAGATAAATGATGTGTCATCGGCAACTAGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 33.40% | 0.11% | 2.33% | NA |
| All Indica | 2759 | 91.70% | 6.40% | 0.14% | 1.78% | NA |
| All Japonica | 1512 | 6.90% | 89.30% | 0.07% | 3.77% | NA |
| Aus | 269 | 95.20% | 4.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 95.80% | 3.20% | 0.00% | 1.01% | NA |
| Indica II | 465 | 84.30% | 10.30% | 0.65% | 4.73% | NA |
| Indica III | 913 | 94.10% | 5.70% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 90.10% | 7.40% | 0.13% | 2.42% | NA |
| Temperate Japonica | 767 | 1.00% | 98.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 15.90% | 73.00% | 0.00% | 11.11% | NA |
| Japonica Intermediate | 241 | 6.60% | 92.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 35.60% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405089398 | G -> DEL | N | N | silent_mutation | Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 | N | N | N | N |
| vg0405089398 | G -> A | LOC_Os04g09490.1 | upstream_gene_variant ; 4319.0bp to feature; MODIFIER | silent_mutation | Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 | N | N | N | N |
| vg0405089398 | G -> A | LOC_Os04g09500.1 | upstream_gene_variant ; 308.0bp to feature; MODIFIER | silent_mutation | Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 | N | N | N | N |
| vg0405089398 | G -> A | LOC_Os04g09510.1 | upstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 | N | N | N | N |
| vg0405089398 | G -> A | LOC_Os04g09500-LOC_Os04g09510 | intergenic_region ; MODIFIER | silent_mutation | Average:13.976; most accessible tissue: Zhenshan97 young leaf, score: 23.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405089398 | NA | 1.14E-15 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 4.32E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 1.72E-27 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 9.84E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | 5.54E-06 | NA | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 1.20E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | 4.59E-06 | NA | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | 6.07E-06 | NA | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | 5.26E-06 | NA | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 6.25E-61 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | 4.35E-08 | 2.65E-10 | mr1489_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 1.56E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 1.68E-30 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 3.66E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405089398 | NA | 5.23E-07 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |