\
| Variant ID: vg0405072995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5072995 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, T: 0.26, others allele: 0.00, population size: 213. )
TTGATAACTGGAAGTATGTTGGAAACCCACTCAGCATATCGGTAAGGACGAATAAAACCAGCATCATACAAACGTTTAACCTCAGCCTTAATAGGTTCGA[G/T]
CATATCGGCTTTGCATCTTCTCGGCGGCTGTTGGTACGGTCTAACCCCCGGTTTGATAGGTAGCCGATGTTCAACAATGGATCGGCTGAGTCCTGGCATC
GATGCCAGGACTCAGCCGATCCATTGTTGAACATCGGCTACCTATCAAACCGGGGGTTAGACCGTACCAACAGCCGCCGAGAAGATGCAAAGCCGATATG[C/A]
TCGAACCTATTAAGGCTGAGGTTAAACGTTTGTATGATGCTGGTTTTATTCGTCCTTACCGATATGCTGAGTGGGTTTCCAACATACTTCCAGTTATCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 33.70% | 0.25% | 2.05% | NA |
| All Indica | 2759 | 91.30% | 7.00% | 0.40% | 1.38% | NA |
| All Japonica | 1512 | 6.90% | 89.40% | 0.00% | 3.70% | NA |
| Aus | 269 | 95.20% | 4.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 95.00% | 4.20% | 0.50% | 0.34% | NA |
| Indica II | 465 | 84.30% | 9.90% | 0.43% | 5.38% | NA |
| Indica III | 913 | 94.10% | 5.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 89.30% | 8.80% | 0.51% | 1.40% | NA |
| Temperate Japonica | 767 | 1.20% | 98.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 15.70% | 73.40% | 0.00% | 10.91% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 35.60% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405072995 | G -> DEL | LOC_Os04g09470.1 | N | frameshift_variant | Average:23.163; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0405072995 | G -> T | LOC_Os04g09470.1 | missense_variant ; p.Leu572Ile; MODERATE | nonsynonymous_codon ; L572I | Average:23.163; most accessible tissue: Zhenshan97 root, score: 51.776 | benign |
0.629 |
DELETERIOUS | 0.02 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405072995 | NA | 2.22E-16 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 2.19E-06 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 1.40E-42 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 5.23E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | 6.56E-06 | 2.12E-29 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | 5.84E-07 | NA | mr1033_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 2.38E-15 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 2.85E-06 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 1.85E-62 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 8.04E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 2.69E-32 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 1.63E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 2.87E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405072995 | NA | 5.79E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |