\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405063978:

Variant ID: vg0405063978 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5063978
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.26, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TACATAAACATGATTAGAGTGTCATGAAGATGTAAGCACTAATACCGAAAACGCAATCCGCCATGACAAGTTTACCTCTAGTTGAATATCGAAACCGATG[C/A]
AGCTCAACCCGAAAGCAAGAACATGTCTATACAAACGAACGTGAAAAAGGGTGGCGATGCGCCGAGATTGTTATTGAACTATTGTTGTTAAATTACATGG

Reverse complement sequence

CCATGTAATTTAACAACAATAGTTCAATAACAATCTCGGCGCATCGCCACCCTTTTTCACGTTCGTTTGTATAGACATGTTCTTGCTTTCGGGTTGAGCT[G/T]
CATCGGTTTCGATATTCAACTAGAGGTAAACTTGTCATGGCGGATTGCGTTTTCGGTATTAGTGCTTACATCTTCATGACACTCTAATCATGTTTATGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 33.30% 0.11% 2.29% NA
All Indica  2759 91.70% 6.40% 0.14% 1.74% NA
All Japonica  1512 7.00% 89.20% 0.07% 3.70% NA
Aus  269 95.20% 4.50% 0.00% 0.37% NA
Indica I  595 95.80% 3.40% 0.00% 0.84% NA
Indica II  465 84.50% 9.50% 0.65% 5.38% NA
Indica III  913 94.20% 5.60% 0.11% 0.11% NA
Indica Intermediate  786 90.10% 7.80% 0.00% 2.16% NA
Temperate Japonica  767 1.30% 98.60% 0.00% 0.13% NA
Tropical Japonica  504 15.90% 73.20% 0.00% 10.91% NA
Japonica Intermediate  241 6.60% 92.90% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 62.20% 34.40% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405063978 C -> DEL N N silent_mutation Average:23.693; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0405063978 C -> A LOC_Os04g09450.1 upstream_gene_variant ; 3020.0bp to feature; MODIFIER silent_mutation Average:23.693; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0405063978 C -> A LOC_Os04g09460.1 upstream_gene_variant ; 806.0bp to feature; MODIFIER silent_mutation Average:23.693; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0405063978 C -> A LOC_Os04g09450-LOC_Os04g09460 intergenic_region ; MODIFIER silent_mutation Average:23.693; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405063978 2.80E-06 4.04E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.76E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 5.80E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 8.81E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 5.34E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 3.38E-28 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 2.60E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 1.24E-06 6.27E-17 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 2.52E-06 3.32E-103 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 4.10E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 7.09E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 2.04E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 4.95E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 3.57E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 1.04E-07 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 1.66E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 2.66E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 2.41E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.64E-65 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 2.02E-08 mr1402_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 4.24E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.94E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 3.75E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 7.77E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 8.41E-09 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.98E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 2.40E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 8.87E-33 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 5.07E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.95E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.61E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.84E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 1.76E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405063978 NA 2.34E-09 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251