\
| Variant ID: vg0405048401 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5048401 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATACATCTGAATTCGATTGATGATAGATCCCAGCTTTTCTACCCCCAGATCAAACTGGTGACCTCCAATCACTACCATCTTTGATCGGTCTGACAAAATC[C/T]
ACAATAGTCTCGGTTCCAAAAAGAACCGAGACTAAAGATTGTTTTTAGTCCCAGTTATAAAAATTTTGATCTCTAGTCCCGGTTCATCCCCTGTCAGATG
CATCTGACAGGGGATGAACCGGGACTAGAGATCAAAATTTTTATAACTGGGACTAAAAACAATCTTTAGTCTCGGTTCTTTTTGGAACCGAGACTATTGT[G/A]
GATTTTGTCAGACCGATCAAAGATGGTAGTGATTGGAGGTCACCAGTTTGATCTGGGGGTAGAAAAGCTGGGATCTATCATCAATCGAATTCAGATGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 2.50% | 0.06% | 2.52% | NA |
| All Indica | 2759 | 93.40% | 4.30% | 0.04% | 2.17% | NA |
| All Japonica | 1512 | 96.20% | 0.00% | 0.13% | 3.70% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.70% | 0.70% | 0.00% | 0.67% | NA |
| Indica II | 465 | 93.50% | 0.00% | 0.22% | 6.24% | NA |
| Indica III | 913 | 94.70% | 5.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 87.90% | 8.80% | 0.00% | 3.31% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 88.70% | 0.00% | 0.40% | 10.91% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405048401 | C -> DEL | N | N | silent_mutation | Average:29.479; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0405048401 | C -> T | LOC_Os04g09430-LOC_Os04g09450 | intergenic_region ; MODIFIER | silent_mutation | Average:29.479; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405048401 | NA | 1.82E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 3.56E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 4.39E-08 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 1.00E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 1.95E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 5.49E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 6.32E-08 | mr1723 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 9.22E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 7.99E-11 | mr1723_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405048401 | NA | 8.96E-06 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |