\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405048401:

Variant ID: vg0405048401 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5048401
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACATCTGAATTCGATTGATGATAGATCCCAGCTTTTCTACCCCCAGATCAAACTGGTGACCTCCAATCACTACCATCTTTGATCGGTCTGACAAAATC[C/T]
ACAATAGTCTCGGTTCCAAAAAGAACCGAGACTAAAGATTGTTTTTAGTCCCAGTTATAAAAATTTTGATCTCTAGTCCCGGTTCATCCCCTGTCAGATG

Reverse complement sequence

CATCTGACAGGGGATGAACCGGGACTAGAGATCAAAATTTTTATAACTGGGACTAAAAACAATCTTTAGTCTCGGTTCTTTTTGGAACCGAGACTATTGT[G/A]
GATTTTGTCAGACCGATCAAAGATGGTAGTGATTGGAGGTCACCAGTTTGATCTGGGGGTAGAAAAGCTGGGATCTATCATCAATCGAATTCAGATGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 2.50% 0.06% 2.52% NA
All Indica  2759 93.40% 4.30% 0.04% 2.17% NA
All Japonica  1512 96.20% 0.00% 0.13% 3.70% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 98.70% 0.70% 0.00% 0.67% NA
Indica II  465 93.50% 0.00% 0.22% 6.24% NA
Indica III  913 94.70% 5.10% 0.00% 0.11% NA
Indica Intermediate  786 87.90% 8.80% 0.00% 3.31% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 88.70% 0.00% 0.40% 10.91% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405048401 C -> DEL N N silent_mutation Average:29.479; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0405048401 C -> T LOC_Os04g09430-LOC_Os04g09450 intergenic_region ; MODIFIER silent_mutation Average:29.479; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405048401 NA 1.82E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 3.56E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 4.39E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 1.00E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 1.95E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 5.49E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 6.32E-08 mr1723 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 9.22E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 7.99E-11 mr1723_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405048401 NA 8.96E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251