\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405046095:

Variant ID: vg0405046095 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5046095
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAACTTGGAGAAATCTGGAACCTTGTATCGATGTGGCAATGAAACCCTATCAAACCACTCAGGATATGGTAGCCGATACACAGAAGTATGTTCCTTA[G/T]
GTTTGATTCCAAACCACTCCTCTATTATCTTTGCAATTCTATCGGCCAAATCTTCTCCATACCGATGTATTTGAATTCCCTCTGACCGATATTGTTGATA

Reverse complement sequence

TATCAACAATATCGGTCAGAGGGAATTCAAATACATCGGTATGGAGAAGATTTGGCCGATAGAATTGCAAAGATAATAGAGGAGTGGTTTGGAATCAAAC[C/A]
TAAGGAACATACTTCTGTGTATCGGCTACCATATCCTGAGTGGTTTGATAGGGTTTCATTGCCACATCGATACAAGGTTCCAGATTTCTCCAAGTTTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 29.80% 0.63% 1.86% NA
All Indica  2759 60.70% 37.10% 0.43% 1.78% NA
All Japonica  1512 92.90% 3.60% 0.99% 2.51% NA
Aus  269 19.30% 80.30% 0.37% 0.00% NA
Indica I  595 42.40% 57.00% 0.17% 0.50% NA
Indica II  465 35.50% 58.30% 1.29% 4.95% NA
Indica III  913 84.90% 15.00% 0.00% 0.11% NA
Indica Intermediate  786 61.50% 35.10% 0.64% 2.80% NA
Temperate Japonica  767 95.30% 4.60% 0.00% 0.13% NA
Tropical Japonica  504 88.10% 1.60% 2.98% 7.34% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 61.10% 35.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405046095 G -> DEL N N silent_mutation Average:26.618; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0405046095 G -> T LOC_Os04g09430.1 upstream_gene_variant ; 3092.0bp to feature; MODIFIER silent_mutation Average:26.618; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0405046095 G -> T LOC_Os04g09430-LOC_Os04g09450 intergenic_region ; MODIFIER silent_mutation Average:26.618; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405046095 NA 2.08E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 3.39E-07 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 2.63E-08 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 1.49E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 3.69E-08 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 2.27E-08 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 2.62E-10 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 1.10E-08 mr1618 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 5.45E-08 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 6.12E-10 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 1.27E-06 1.27E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 1.86E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 9.21E-08 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 1.65E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 3.80E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 4.49E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 4.51E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405046095 NA 5.51E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251