Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405036104:

Variant ID: vg0405036104 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5036104
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.46, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CTATATGCCAATATGCCCTACACCAAAATTATCTATCAAAAGACTATGTACCTATGCAGTGTCTATAGTTAATTTGATTGATAATGTTATGTCCATCTTC[T/C]
ACGTATAAATGACTTTACAAATGAAGTATTGTTTTTATGGATGTATGTAAATTATTTTGAGTAAATTGGTCATTTACATTTGAAGCAATTTTGGCCTAGA

Reverse complement sequence

TCTAGGCCAAAATTGCTTCAAATGTAAATGACCAATTTACTCAAAATAATTTACATACATCCATAAAAACAATACTTCATTTGTAAAGTCATTTATACGT[A/G]
GAAGATGGACATAACATTATCAATCAAATTAACTATAGACACTGCATAGGTACATAGTCTTTTGATAGATAATTTTGGTGTAGGGCATATTGGCATATAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.10%	26.30%	0.51%	3.09%	NA
All Indica	2759	93.10%	3.50%	0.87%	2.50%	NA
All Japonica	1512	22.20%	72.90%	0.00%	4.89%	NA
Aus	269	96.30%	3.30%	0.00%	0.37%	NA
Indica I	595	96.30%	3.00%	0.00%	0.67%	NA
Indica II	465	88.80%	4.10%	0.65%	6.45%	NA
Indica III	913	95.40%	2.40%	1.53%	0.66%	NA
Indica Intermediate	786	90.70%	4.70%	0.89%	3.69%	NA
Temperate Japonica	767	7.40%	92.40%	0.00%	0.13%	NA
Tropical Japonica	504	30.80%	54.80%	0.00%	14.48%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405036104	T -> C	LOC_Os04g09420.1	upstream_gene_variant ; 1042.0bp to feature; MODIFIER	silent_mutation	Average:10.401; most accessible tissue: Zhenshan97 flag leaf, score: 18.298	N	N	N	N
vg0405036104	T -> C	LOC_Os04g09430.1	downstream_gene_variant ; 4246.0bp to feature; MODIFIER	silent_mutation	Average:10.401; most accessible tissue: Zhenshan97 flag leaf, score: 18.298	N	N	N	N
vg0405036104	T -> C	LOC_Os04g09420-LOC_Os04g09430	intergenic_region ; MODIFIER	silent_mutation	Average:10.401; most accessible tissue: Zhenshan97 flag leaf, score: 18.298	N	N	N	N
vg0405036104	T -> DEL	N	N	silent_mutation	Average:10.401; most accessible tissue: Zhenshan97 flag leaf, score: 18.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405036104	NA	2.17E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405036104	1.27E-06	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251