\
| Variant ID: vg0405035806 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5035806 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 82. )
GCATAAAAGGACATCATGTAAGTAGTTGCATGTAGCAAATACATTTATTGGGCAAATGAGTAATAGAATTATTCATATATCTTCTCTTTGTCCAATTGTC[G/A]
CCACATTTGTGGAAGACACAATTATATATTCTCCGCATAGAATAAATGTATACACTCATCATGAAGAGAGTATATTATTGACTTAGAGATATTTATTAGT
ACTAATAAATATCTCTAAGTCAATAATATACTCTCTTCATGATGAGTGTATACATTTATTCTATGCGGAGAATATATAATTGTGTCTTCCACAAATGTGG[C/T]
GACAATTGGACAAAGAGAAGATATATGAATAATTCTATTACTCATTTGCCCAATAAATGTATTTGCTACATGCAACTACTTACATGATGTCCTTTTATGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 37.40% | 0.38% | 3.15% | NA |
| All Indica | 2759 | 83.40% | 13.40% | 0.62% | 2.65% | NA |
| All Japonica | 1512 | 6.90% | 88.20% | 0.07% | 4.83% | NA |
| Aus | 269 | 91.10% | 8.60% | 0.00% | 0.37% | NA |
| Indica I | 595 | 89.70% | 9.60% | 0.17% | 0.50% | NA |
| Indica II | 465 | 81.90% | 11.40% | 1.94% | 4.73% | NA |
| Indica III | 913 | 83.10% | 14.70% | 0.00% | 2.19% | NA |
| Indica Intermediate | 786 | 79.60% | 15.90% | 0.89% | 3.56% | NA |
| Temperate Japonica | 767 | 1.00% | 98.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 15.70% | 69.80% | 0.20% | 14.29% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405035806 | G -> DEL | N | N | silent_mutation | Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| vg0405035806 | G -> A | LOC_Os04g09420.1 | upstream_gene_variant ; 744.0bp to feature; MODIFIER | silent_mutation | Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| vg0405035806 | G -> A | LOC_Os04g09430.1 | downstream_gene_variant ; 4544.0bp to feature; MODIFIER | silent_mutation | Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| vg0405035806 | G -> A | LOC_Os04g09420-LOC_Os04g09430 | intergenic_region ; MODIFIER | silent_mutation | Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405035806 | NA | 3.99E-15 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | NA | 6.89E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | NA | 2.88E-25 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | NA | 1.57E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | NA | 2.27E-17 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | 1.76E-06 | NA | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | NA | 1.89E-06 | mr1274_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | NA | 5.89E-07 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405035806 | NA | 1.04E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |