\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405035806:

Variant ID: vg0405035806 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5035806
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GCATAAAAGGACATCATGTAAGTAGTTGCATGTAGCAAATACATTTATTGGGCAAATGAGTAATAGAATTATTCATATATCTTCTCTTTGTCCAATTGTC[G/A]
CCACATTTGTGGAAGACACAATTATATATTCTCCGCATAGAATAAATGTATACACTCATCATGAAGAGAGTATATTATTGACTTAGAGATATTTATTAGT

Reverse complement sequence

ACTAATAAATATCTCTAAGTCAATAATATACTCTCTTCATGATGAGTGTATACATTTATTCTATGCGGAGAATATATAATTGTGTCTTCCACAAATGTGG[C/T]
GACAATTGGACAAAGAGAAGATATATGAATAATTCTATTACTCATTTGCCCAATAAATGTATTTGCTACATGCAACTACTTACATGATGTCCTTTTATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 37.40% 0.38% 3.15% NA
All Indica  2759 83.40% 13.40% 0.62% 2.65% NA
All Japonica  1512 6.90% 88.20% 0.07% 4.83% NA
Aus  269 91.10% 8.60% 0.00% 0.37% NA
Indica I  595 89.70% 9.60% 0.17% 0.50% NA
Indica II  465 81.90% 11.40% 1.94% 4.73% NA
Indica III  913 83.10% 14.70% 0.00% 2.19% NA
Indica Intermediate  786 79.60% 15.90% 0.89% 3.56% NA
Temperate Japonica  767 1.00% 98.80% 0.00% 0.13% NA
Tropical Japonica  504 15.70% 69.80% 0.20% 14.29% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405035806 G -> DEL N N silent_mutation Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 N N N N
vg0405035806 G -> A LOC_Os04g09420.1 upstream_gene_variant ; 744.0bp to feature; MODIFIER silent_mutation Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 N N N N
vg0405035806 G -> A LOC_Os04g09430.1 downstream_gene_variant ; 4544.0bp to feature; MODIFIER silent_mutation Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 N N N N
vg0405035806 G -> A LOC_Os04g09420-LOC_Os04g09430 intergenic_region ; MODIFIER silent_mutation Average:10.659; most accessible tissue: Zhenshan97 flower, score: 20.672 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405035806 NA 3.99E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 NA 6.89E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 NA 2.88E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 NA 1.57E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 NA 2.27E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 1.76E-06 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 NA 1.89E-06 mr1274_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 NA 5.89E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405035806 NA 1.04E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251