\
| Variant ID: vg0405015610 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5015610 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.39, others allele: 0.00, population size: 82. )
TCGCAACCAATTTTTCCACATCGACAAACAAGTTTGGTGTGAGTGGGATCATTGGTACTAAGCCCGAGAGCATGGCTTCCGTGGAACCACGGGGTGAAGC[A/G]
TCATCAACATCCTACATGAGTAATGCAATTATTGGGTAGATCTGTCGGTTCGTCACACGAACCGAGGCCAGTCAAGTTAACATGCACACTAGCAATGCAA
TTGCATTGCTAGTGTGCATGTTAACTTGACTGGCCTCGGTTCGTGTGACGAACCGACAGATCTACCCAATAATTGCATTACTCATGTAGGATGTTGATGA[T/C]
GCTTCACCCCGTGGTTCCACGGAAGCCATGCTCTCGGGCTTAGTACCAATGATCCCACTCACACCAAACTTGTTTGTCGATGTGGAAAAATTGGTTGCGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.10% | 0.20% | 6.31% | 62.40% | NA |
| All Indica | 2759 | 11.00% | 0.30% | 9.53% | 79.23% | NA |
| All Japonica | 1512 | 73.50% | 0.10% | 1.19% | 25.20% | NA |
| Aus | 269 | 5.60% | 0.00% | 3.35% | 91.08% | NA |
| Indica I | 595 | 8.60% | 0.70% | 5.38% | 85.38% | NA |
| Indica II | 465 | 6.90% | 0.00% | 16.77% | 76.34% | NA |
| Indica III | 913 | 12.20% | 0.20% | 8.98% | 78.64% | NA |
| Indica Intermediate | 786 | 13.90% | 0.10% | 9.03% | 76.97% | NA |
| Temperate Japonica | 767 | 92.80% | 0.10% | 0.00% | 7.04% | NA |
| Tropical Japonica | 504 | 55.60% | 0.20% | 3.37% | 40.87% | NA |
| Japonica Intermediate | 241 | 49.40% | 0.00% | 0.41% | 50.21% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 4.17% | 84.38% | NA |
| Intermediate | 90 | 33.30% | 0.00% | 4.44% | 62.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405015610 | A -> DEL | N | N | silent_mutation | Average:11.343; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| vg0405015610 | A -> G | LOC_Os04g09390-LOC_Os04g09410 | intergenic_region ; MODIFIER | silent_mutation | Average:11.343; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405015610 | NA | 2.42E-14 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405015610 | NA | 8.77E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405015610 | NA | 2.26E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405015610 | NA | 2.03E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405015610 | 2.06E-07 | 7.00E-07 | mr1826 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405015610 | NA | 2.64E-12 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405015610 | NA | 1.27E-09 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |