\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405008302:

Variant ID: vg0405008302 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5008302
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, C: 0.46, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGTCGACAGGAGGATACGTACATGCGTTTGTTTTGTTTGCAGATGTATTCAATCGGTCCACTATCAGGACAAATAGAGGAAGAGCGTGTATATGTTTA[G/C]
GTGGGCTGGTGTGGGAGAGGAAAAGGACGCGAATTGTGGAGTCTTTTTAAGGATAAATCTAATATTCTATGGGTCCACCAGTTTATTTTATTAGATTGCC

Reverse complement sequence

GGCAATCTAATAAAATAAACTGGTGGACCCATAGAATATTAGATTTATCCTTAAAAAGACTCCACAATTCGCGTCCTTTTCCTCTCCCACACCAGCCCAC[C/G]
TAAACATATACACGCTCTTCCTCTATTTGTCCTGATAGTGGACCGATTGAATACATCTGCAAACAAAACAAACGCATGTACGTATCCTCCTGTCGACTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 32.40% 0.23% 3.13% NA
All Indica  2759 91.00% 5.50% 0.29% 3.19% NA
All Japonica  1512 8.30% 87.80% 0.07% 3.77% NA
Aus  269 95.20% 4.50% 0.00% 0.37% NA
Indica I  595 96.10% 3.20% 0.00% 0.67% NA
Indica II  465 78.70% 12.00% 0.43% 8.82% NA
Indica III  913 97.20% 2.60% 0.11% 0.11% NA
Indica Intermediate  786 87.20% 6.90% 0.64% 5.34% NA
Temperate Japonica  767 1.20% 98.60% 0.13% 0.13% NA
Tropical Japonica  504 19.60% 69.20% 0.00% 11.11% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 64.40% 31.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405008302 G -> C LOC_Os04g09390.1 upstream_gene_variant ; 2092.0bp to feature; MODIFIER silent_mutation Average:37.762; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0405008302 G -> C LOC_Os04g09380.1 downstream_gene_variant ; 4366.0bp to feature; MODIFIER silent_mutation Average:37.762; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0405008302 G -> C LOC_Os04g09390-LOC_Os04g09410 intergenic_region ; MODIFIER silent_mutation Average:37.762; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N
vg0405008302 G -> DEL N N silent_mutation Average:37.762; most accessible tissue: Zhenshan97 root, score: 75.275 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405008302 NA 3.94E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 2.47E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 2.88E-45 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 2.55E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 2.60E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 2.26E-28 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 1.26E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 1.11E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 3.44E-16 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 6.31E-07 3.17E-103 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 5.90E-07 1.30E-101 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 1.50E-06 2.61E-58 mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 1.07E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 1.39E-68 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 2.30E-07 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 1.47E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 2.49E-06 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 5.47E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 5.79E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 5.21E-06 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405008302 NA 5.22E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251