\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404977420:

Variant ID: vg0404977420 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 4977420
Reference Allele: GTTAlternative Allele: ATT,G,GCCTTT,GCCTT
Primary Allele: GTTSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGAAGGCATCCGATTAGGTTAAATATCGATGTTGACTTAGATTATATAGGATATCTACCACTCTATGAAACATCCAACGGCTTGATTGTCTAGATATT[GTT/ATT,G,GCCTTT,GCCTT]
CTTCTTTTCATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCTCAATCTCTAGCCTGCTTTTGGTTGCCGATTAGGGTAGT

Reverse complement sequence

ACTACCCTAATCGGCAACCAAAAGCAGGCTAGAGATTGAGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATGAAAAGAAG[AAC/AAT,C,AAAGGC,AAGGC]
AATATCTAGACAATCAAGCCGTTGGATGTTTCATAGAGTGGTAGATATCCTATATAATCTAAGTCAACATCGATATTTAACCTAATCGGATGCCTTCTAG

Allele Frequencies:

Populations Population SizeFrequency of GTT(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 0.20% 1.14% 31.49% ATT: 0.11%; GCCTTT: 0.06%; GCCTT: 0.04%
All Indica  2759 57.30% 0.40% 1.38% 40.63% ATT: 0.18%; GCCTTT: 0.07%; GCCTT: 0.04%
All Japonica  1512 85.80% 0.00% 0.66% 13.49% NA
Aus  269 57.20% 0.00% 2.23% 39.78% GCCTT: 0.37%; GCCTTT: 0.37%
Indica I  595 51.40% 0.00% 1.68% 46.89% NA
Indica II  465 68.00% 1.30% 1.72% 28.60% GCCTTT: 0.43%
Indica III  913 57.00% 0.40% 1.53% 40.85% GCCTT: 0.11%; ATT: 0.11%
Indica Intermediate  786 55.90% 0.10% 0.76% 42.75% ATT: 0.51%
Temperate Japonica  767 95.30% 0.00% 0.52% 4.17% NA
Tropical Japonica  504 75.60% 0.00% 0.79% 23.61% NA
Japonica Intermediate  241 77.20% 0.00% 0.83% 21.99% NA
VI/Aromatic  96 65.60% 0.00% 0.00% 34.38% NA
Intermediate  90 74.40% 0.00% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404977420 GTT -> G LOC_Os04g09350.1 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> G LOC_Os04g09350.4 downstream_gene_variant ; 2131.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> G LOC_Os04g09350.3 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> G LOC_Os04g09350.2 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> G LOC_Os04g09360.1 intron_variant ; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> DEL N N silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTT LOC_Os04g09350.1 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTT LOC_Os04g09350.4 downstream_gene_variant ; 2131.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTT LOC_Os04g09350.3 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTT LOC_Os04g09350.2 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTT LOC_Os04g09360.1 intron_variant ; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTTT LOC_Os04g09350.1 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTTT LOC_Os04g09350.4 downstream_gene_variant ; 2131.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTTT LOC_Os04g09350.3 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTTT LOC_Os04g09350.2 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> GCCTTT LOC_Os04g09360.1 intron_variant ; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> ATT LOC_Os04g09350.1 downstream_gene_variant ; 2051.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> ATT LOC_Os04g09350.4 downstream_gene_variant ; 2130.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> ATT LOC_Os04g09350.3 downstream_gene_variant ; 2051.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> ATT LOC_Os04g09350.2 downstream_gene_variant ; 2051.0bp to feature; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0404977420 GTT -> ATT LOC_Os04g09360.1 intron_variant ; MODIFIER silent_mutation Average:13.541; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404977420 1.40E-07 NA mr1087 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251