Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404977420:

Variant ID: vg0404977420 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 4977420
Reference Allele: GTT	Alternative Allele: ATT,G,GCCTTT,GCCTT
Primary Allele: GTT	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGAAGGCATCCGATTAGGTTAAATATCGATGTTGACTTAGATTATATAGGATATCTACCACTCTATGAAACATCCAACGGCTTGATTGTCTAGATATT[GTT/ATT,G,GCCTTT,GCCTT]
CTTCTTTTCATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCTCAATCTCTAGCCTGCTTTTGGTTGCCGATTAGGGTAGT

Reverse complement sequence

ACTACCCTAATCGGCAACCAAAAGCAGGCTAGAGATTGAGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATGAAAAGAAG[AAC/AAT,C,AAAGGC,AAGGC]
AATATCTAGACAATCAAGCCGTTGGATGTTTCATAGAGTGGTAGATATCCTATATAATCTAAGTCAACATCGATATTTAACCTAATCGGATGCCTTCTAG

Allele Frequencies:

Populations	Population Size	Frequency of GTT(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	0.20%	1.14%	31.49%	ATT: 0.11%; GCCTTT: 0.06%; GCCTT: 0.04%
All Indica	2759	57.30%	0.40%	1.38%	40.63%	ATT: 0.18%; GCCTTT: 0.07%; GCCTT: 0.04%
All Japonica	1512	85.80%	0.00%	0.66%	13.49%	NA
Aus	269	57.20%	0.00%	2.23%	39.78%	GCCTT: 0.37%; GCCTTT: 0.37%
Indica I	595	51.40%	0.00%	1.68%	46.89%	NA
Indica II	465	68.00%	1.30%	1.72%	28.60%	GCCTTT: 0.43%
Indica III	913	57.00%	0.40%	1.53%	40.85%	GCCTT: 0.11%; ATT: 0.11%
Indica Intermediate	786	55.90%	0.10%	0.76%	42.75%	ATT: 0.51%
Temperate Japonica	767	95.30%	0.00%	0.52%	4.17%	NA
Tropical Japonica	504	75.60%	0.00%	0.79%	23.61%	NA
Japonica Intermediate	241	77.20%	0.00%	0.83%	21.99%	NA
VI/Aromatic	96	65.60%	0.00%	0.00%	34.38%	NA
Intermediate	90	74.40%	0.00%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404977420	GTT -> G	LOC_Os04g09350.1	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> G	LOC_Os04g09350.4	downstream_gene_variant ; 2131.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> G	LOC_Os04g09350.3	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> G	LOC_Os04g09350.2	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> G	LOC_Os04g09360.1	intron_variant ; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> DEL	N	N	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTT	LOC_Os04g09350.1	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTT	LOC_Os04g09350.4	downstream_gene_variant ; 2131.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTT	LOC_Os04g09350.3	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTT	LOC_Os04g09350.2	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTT	LOC_Os04g09360.1	intron_variant ; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTTT	LOC_Os04g09350.1	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTTT	LOC_Os04g09350.4	downstream_gene_variant ; 2131.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTTT	LOC_Os04g09350.3	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTTT	LOC_Os04g09350.2	downstream_gene_variant ; 2052.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> GCCTTT	LOC_Os04g09360.1	intron_variant ; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> ATT	LOC_Os04g09350.1	downstream_gene_variant ; 2051.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> ATT	LOC_Os04g09350.4	downstream_gene_variant ; 2130.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> ATT	LOC_Os04g09350.3	downstream_gene_variant ; 2051.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> ATT	LOC_Os04g09350.2	downstream_gene_variant ; 2051.0bp to feature; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0404977420	GTT -> ATT	LOC_Os04g09360.1	intron_variant ; MODIFIER	silent_mutation	Average:13.541; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404977420	1.40E-07	NA	mr1087	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251