RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0404968530:

Variant ID: vg0404968530 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4968530
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, G: 0.41, others allele: 0.00, population size: 27. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAGGTTTGTGAAATGATATTTGAAAACTCAACTTTACGCAAAGTAACCATAGCCACTCTAGTAATACCCTTACATTACTGCATTTTGTGTGGTGGCTT[C/G]
CTGAGTACTTTTGTACTCATTGTTGCTCTATATATATATATCTTTTAGCAGAGTGTTGAAGAGAAGCCCTTGTTTGTACGCTTGCGTACCTAACAAGATG

Reverse complement sequence

CATCTTGTTAGGTACGCAAGCGTACAAACAAGGGCTTCTCTTCAACACTCTGCTAAAAGATATATATATATAGAGCAACAATGAGTACAAAAGTACTCAG[G/C]
AAGCCACCACACAAAATGCAGTAATGTAAGGGTATTACTAGAGTGGCTATGGTTACTTTGCGTAAAGTTGAGTTTTCAAATATCATTTCACAAACCTAAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.50%	1.10%	0.78%	64.54%	NA
All Indica	2759	13.60%	1.50%	1.09%	83.80%	NA
All Japonica	1512	75.70%	0.30%	0.20%	23.88%	NA
Aus	269	6.30%	2.20%	0.74%	90.71%	NA
Indica I	595	20.20%	0.20%	1.01%	78.66%	NA
Indica II	465	19.80%	5.40%	3.23%	71.61%	NA
Indica III	913	3.80%	0.70%	0.33%	95.18%	NA
Indica Intermediate	786	16.30%	1.30%	0.76%	81.68%	NA
Temperate Japonica	767	91.80%	0.00%	0.00%	8.21%	NA
Tropical Japonica	504	57.70%	0.60%	0.40%	41.27%	NA
Japonica Intermediate	241	61.80%	0.40%	0.41%	37.34%	NA
VI/Aromatic	96	15.60%	1.00%	0.00%	83.33%	NA
Intermediate	90	37.80%	1.10%	2.22%	58.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404968530	C -> DEL	N	N	silent_mutation	Average:25.194; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0404968530	C -> G	LOC_Os04g09340.1	upstream_gene_variant ; 3380.0bp to feature; MODIFIER	silent_mutation	Average:25.194; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0404968530	C -> G	LOC_Os04g09350.1	upstream_gene_variant ; 1449.0bp to feature; MODIFIER	silent_mutation	Average:25.194; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0404968530	C -> G	LOC_Os04g09350.2	upstream_gene_variant ; 1449.0bp to feature; MODIFIER	silent_mutation	Average:25.194; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0404968530	C -> G	LOC_Os04g09350.4	intron_variant ; MODIFIER	silent_mutation	Average:25.194; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0404968530	C -> G	LOC_Os04g09350.3	intron_variant ; MODIFIER	silent_mutation	Average:25.194; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404968530	4.19E-06	NA	mr1027_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 1 of 1 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0404968530:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact