\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404875536:

Variant ID: vg0404875536 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4875536
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CCATTCGGCTAGCTTTATTGATCATTAAACATTAAACATTGTTACATCGTTTGCCAAAGCGCTTAGAATATAACCAGGAGGTTCATCGACCCAAGTACAA[G/T,A]
ACTCTTTCGTACTAAAAGCAATAGTTCTTTCTTTATTGAAAAGGAAAACGTGATGAAGTTTCATTCCACACGTGTTTAGAATTCCATCTATAAATTAATT

Reverse complement sequence

AATTAATTTATAGATGGAATTCTAAACACGTGTGGAATGAAACTTCATCACGTTTTCCTTTTCAATAAAGAAAGAACTATTGCTTTTAGTACGAAAGAGT[C/A,T]
TTGTACTTGGGTCGATGAACCTCCTGGTTATATTCTAAGCGCTTTGGCAAACGATGTAACAATGTTTAATGTTTAATGATCAATAAAGCTAGCCGAATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 4.50% 1.40% 0.00% NA
All Indica  2759 99.40% 0.20% 0.40% 0.00% NA
All Japonica  1512 83.00% 13.40% 3.64% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 97.80% 1.10% 1.08% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.40% 0.10% 0.51% 0.00% NA
Temperate Japonica  767 69.60% 24.10% 6.26% 0.00% NA
Tropical Japonica  504 97.20% 2.20% 0.60% 0.00% NA
Japonica Intermediate  241 95.90% 2.50% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404875536 G -> A LOC_Os04g08828.1 5_prime_UTR_variant ; 164.0bp to feature; MODIFIER N Average:40.501; most accessible tissue: Callus, score: 76.707 N N N N
vg0404875536 G -> A LOC_Os04g08824.1 downstream_gene_variant ; 3385.0bp to feature; MODIFIER N Average:40.501; most accessible tissue: Callus, score: 76.707 N N N N
vg0404875536 G -> T LOC_Os04g08828.1 5_prime_UTR_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:40.501; most accessible tissue: Callus, score: 76.707 N N N N
vg0404875536 G -> T LOC_Os04g08824.1 downstream_gene_variant ; 3385.0bp to feature; MODIFIER silent_mutation Average:40.501; most accessible tissue: Callus, score: 76.707 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404875536 1.40E-07 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404875536 NA 5.00E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404875536 1.57E-06 1.20E-06 mr1525 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251