Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0404806537:

Variant ID: vg0404806537 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4806537
Reference Allele: A	Alternative Allele: G,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

CACGTGGCAATCCAGTCAGCATTTTATTTTTTAAAAAATAGTGGGACCCACTTGTCATACCATATCTTCCCCTCTTCCTTTTCCTCTCTCTCAGGCTCAG[A/G,C]
GCGTGCACGGCGAGCGGCGGCGCGCGGGGGAGGACAGGCAGTCGGTGCGCGGGGGCCGGCGATGGGCGGTGACGTGCTGGGGCGGACGGGCGGTCGGCGC

Reverse complement sequence

GCGCCGACCGCCCGTCCGCCCCAGCACGTCACCGCCCATCGCCGGCCCCCGCGCACCGACTGCCTGTCCTCCCCCGCGCGCCGCCGCTCGCCGTGCACGC[T/C,G]
CTGAGCCTGAGAGAGAGGAAAAGGAAGAGGGGAAGATATGGTATGACAAGTGGGTCCCACTATTTTTTAAAAAATAAAATGCTGACTGGATTGCCACGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	9.60%	1.33%	10.73%	C: 0.02%
All Indica	2759	79.40%	3.70%	0.80%	16.09%	NA
All Japonica	1512	72.80%	22.70%	2.65%	1.85%	C: 0.07%
Aus	269	88.50%	0.40%	0.00%	11.15%	NA
Indica I	595	99.00%	0.70%	0.17%	0.17%	NA
Indica II	465	78.50%	8.00%	1.29%	12.26%	NA
Indica III	913	68.50%	2.30%	0.77%	28.48%	NA
Indica Intermediate	786	77.70%	5.20%	1.02%	16.03%	NA
Temperate Japonica	767	85.10%	14.00%	0.52%	0.26%	C: 0.13%
Tropical Japonica	504	63.70%	25.20%	6.75%	4.37%	NA
Japonica Intermediate	241	52.30%	45.20%	0.83%	1.66%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	8.90%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404806537	A -> C	LOC_Os04g08792.1	upstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:67.305; most accessible tissue: Zhenshan97 flag leaf, score: 83.684	N	N	N	N
vg0404806537	A -> C	LOC_Os04g08796.1	upstream_gene_variant ; 4087.0bp to feature; MODIFIER	silent_mutation	Average:67.305; most accessible tissue: Zhenshan97 flag leaf, score: 83.684	N	N	N	N
vg0404806537	A -> C	LOC_Os04g08792-LOC_Os04g08796	intergenic_region ; MODIFIER	silent_mutation	Average:67.305; most accessible tissue: Zhenshan97 flag leaf, score: 83.684	N	N	N	N
vg0404806537	A -> DEL	N	N	silent_mutation	Average:67.305; most accessible tissue: Zhenshan97 flag leaf, score: 83.684	N	N	N	N
vg0404806537	A -> G	LOC_Os04g08792.1	upstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:67.305; most accessible tissue: Zhenshan97 flag leaf, score: 83.684	N	N	N	N
vg0404806537	A -> G	LOC_Os04g08796.1	upstream_gene_variant ; 4087.0bp to feature; MODIFIER	silent_mutation	Average:67.305; most accessible tissue: Zhenshan97 flag leaf, score: 83.684	N	N	N	N
vg0404806537	A -> G	LOC_Os04g08792-LOC_Os04g08796	intergenic_region ; MODIFIER	silent_mutation	Average:67.305; most accessible tissue: Zhenshan97 flag leaf, score: 83.684	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404806537	4.22E-07	NA	mr1679	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404806537	2.10E-07	NA	mr1693	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404806537	3.77E-06	NA	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404806537	4.93E-06	NA	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251